Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primer pair, probe and detection kit for detecting carp spring virus

A detection kit, a technology for carp spring virus, applied in the field of probes, specific primer pairs, and detection kits, can solve the problems of limiting the use of LAMP method, indistinguishable non-specific amplification, false positive results, etc., to avoid false positives. The effect of positive results, easy to popularize and use, and high accuracy

Active Publication Date: 2021-05-25
江苏省渔业技术推广中心 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although LAMP increases the amplification efficiency, non-specific pairing between primers easily leads to false positive results, which limits the use of LAMP methods
[0007] At present, conventional PCR requires better temperature control instruments, especially for fluorescent quantitative PCR instruments, which are very expensive
Conventional PCR requires thermal denaturation / annealing / extension to repeat multiple cycles, which takes at least 2 hours; there are also a small amount of public information or patent literature on isothermal amplification testing, but they are all LAMP techniques, and their amplification time is about 45 minutes to 1 hour, the temperature requirement is higher, about 65°C, and it is very sensitive to temperature, and the temperature needs to be strictly controlled
Moreover, fluorescent dyes such as sybrgreen are used to judge whether the amplification is or not, and it is impossible to distinguish non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair, probe and detection kit for detecting carp spring virus
  • Specific primer pair, probe and detection kit for detecting carp spring virus
  • Specific primer pair, probe and detection kit for detecting carp spring virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] 1. Acquisition of the positive plasmid of carp spring virus: through the NCBI search literature, the common carp spring virus glycoprotein G gene is listed, and the vector NTI software is used to compare and find out its conserved region, and the selected region of the glycoprotein G gene is used as the target The amplified segment was constructed into the vector puc57 to prepare the positive plasmid of carp spring virus. The plasmid was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The partial sequence of the selected glycoprotein G gene is as follows:

[0060] ATTTCAAGGATTGCATCAGGAACTGATGAAGATCTGGGGTTTCCCCCTCAAAGTTGCGGATGGGCATCTGTCACAACAGTGTCAAATACTAATTACAAGGTAGTACCCCATTCTGTTCATTTGGAGCCGTACGGAGGACACTGGATCGATCATGAATTCAATGGGGGCGAATGCAGAGAAAAAGTGTGTGAAATGAAAGGGAACCACTCTATTTGGATCACAGATGAGACCGTGCAGCATGAATGTGAAAAGCACATAGAGGAAGTTGAAGGAATTATGTACGGGAATGCTCCGAGAGGGGATGCAATATATATTAACAACTTTATTATAGATAAACATCATAGAGTATACAGATTCGGGGGGTCTTGTCGAATGAAATTCTGTAATAAAGATGGTATAAAATTC...

Embodiment 2

[0090] Select the primers and probe sequences designed in Example 1, carry out the amplification test of the method version of the recombinase polymerase amplification (in conjunction with endonuclease IV), and construct a 25 μl amplification reaction system as follows:

[0091] 30mM tris-acetic acid buffer pH8.0

[0092] 100mM potassium acetate

[0093] 14mM magnesium acetate

[0094] 3mM Dithiothreitol

[0095] 5% polyethylene glycol (20000)

[0096] 2mM ATP

[0097] 20mM creatine phosphate

[0098] 100ng / μl creatine kinase

[0099] 400ng / μl E. coli recA protein

[0100] 200ng / μl E. coli SSB protein

[0101] 60ng / μl E. coli recO protein

[0102] 40ng / μl E. coli recR protein

[0103] 60ng / μl E. coli recF protein

[0104] 8 Units Bacillus subtilis DNA polymerase I

[0105] 4U / μl reverse transcriptase

[0106] 50ng / μl Endonuclease IV

[0107] 450 μM dNTPs

[0108] 420nM per upstream primer

[0109] 420nM each downstream primer

[0110] 120nM fluorescent probe

...

Embodiment 3

[0115] Select the plasmid containing the gene sequence of the conserved region of carp spring virus as the detection target through synthesis,

[0116] The upstream primer sequence is: 5'-TGGGCATCTGTCACAACAGTGTCAAATACT-3' (Seq ID No.3);

[0117] The downstream primer sequence is: 5'-TCTCGGAGCATTCCCGTACATAATTCCTTC-3'(Seq ID No.4);

[0118] The probe sequence is: 5'-AAGTGTGTGAAATGAAAGGGAACCACTC(FAM-dT)A(THF)(BHQ1-dT)TGGATCACAGATGAG(C3-SPACER)-3'.

[0119] Utilize recombinase polymerase amplification (combined with exonuclease III) method to amplify the reaction system to amplify, and construct a 25 μl amplification reaction system as follows:

[0120] 60mM tris-acetic acid buffer pH8.0

[0121] 100mM potassium acetate

[0122] 14mM magnesium acetate

[0123] 3mM Dithiothreitol

[0124] 5% polyethylene glycol (molecular weight 20000)

[0125] 2mM ATP

[0126] 20mM creatine phosphate

[0127] 100ng / μl creatine kinase

[0128] 600ng / μl phage gp32 protein

[0129] 150ng / μl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pair of specific primers for detecting carp spring virus. The invention also discloses a probe used in conjunction with the primer pair. The invention also discloses a detection kit. The present invention takes the glycoprotein G gene in the carp spring virus as the detection target, uses the constant temperature amplification technology, uses specific primers and probe combinations, improves the detection convenience and specificity of the carp spring virus, and at the same time the detection time is greatly improved. shorten. Compared with the PCR detection method, the method of the present invention saves the product electrophoresis verification process, avoids false positive results, and improves detection accuracy. Compared with qPCR, the method of the present invention is simple and easy to operate, and does not require complex instruments and equipment, which saves costs, improves detection efficiency, and is convenient for popularization and use in a wide range. Compared with other constant temperature amplification methods, the detection method of the present invention requires shorter time and higher detection accuracy.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a pair of specific primers, a probe and a detection kit for detecting carp spring virus. Background technique [0002] Spring viraemia of carp (SVC) is a hemorrhagic and highly contagious disease caused by a virus in fish, often in carps, especially carps and koi. The outbreak occurred in spring, resulting in the death of a large number of diseased fish and bringing huge economic losses to fish farmers. According to the regulations of the International Organization for Animal Health (OIE), carp spring viremia is a disease that must be reported to OIE, and it is also a second-class animal in the "List of Class I and Class II Infectious and Parasitic Diseases of Imported Animals of the People's Republic of China" blight. The pathogen of the disease is spring viraemia of carpvirus (SVCV), also known as Rhabdovirus carpio, which belongs to Rhabdoviridae and belongs to the genus Vesiculor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/701C12Q2521/507C12Q2522/101
Inventor 陈静高山珊方苹贡成良于继彬
Owner 江苏省渔业技术推广中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products