Specific primer pair, probe and detection kit for detecting carp spring virus
A detection kit, a technology for carp spring virus, applied in the field of probes, specific primer pairs, and detection kits, can solve the problems of limiting the use of LAMP method, indistinguishable non-specific amplification, false positive results, etc., to avoid false positives. The effect of positive results, easy to popularize and use, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] 1. Acquisition of the positive plasmid of carp spring virus: through the NCBI search literature, the common carp spring virus glycoprotein G gene is listed, and the vector NTI software is used to compare and find out its conserved region, and the selected region of the glycoprotein G gene is used as the target The amplified segment was constructed into the vector puc57 to prepare the positive plasmid of carp spring virus. The plasmid was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The partial sequence of the selected glycoprotein G gene is as follows:
[0060] ATTTCAAGGATTGCATCAGGAACTGATGAAGATCTGGGGTTTCCCCCTCAAAGTTGCGGATGGGCATCTGTCACAACAGTGTCAAATACTAATTACAAGGTAGTACCCCATTCTGTTCATTTGGAGCCGTACGGAGGACACTGGATCGATCATGAATTCAATGGGGGCGAATGCAGAGAAAAAGTGTGTGAAATGAAAGGGAACCACTCTATTTGGATCACAGATGAGACCGTGCAGCATGAATGTGAAAAGCACATAGAGGAAGTTGAAGGAATTATGTACGGGAATGCTCCGAGAGGGGATGCAATATATATTAACAACTTTATTATAGATAAACATCATAGAGTATACAGATTCGGGGGGTCTTGTCGAATGAAATTCTGTAATAAAGATGGTATAAAATTC...
Embodiment 2
[0090] Select the primers and probe sequences designed in Example 1, carry out the amplification test of the method version of the recombinase polymerase amplification (in conjunction with endonuclease IV), and construct a 25 μl amplification reaction system as follows:
[0091] 30mM tris-acetic acid buffer pH8.0
[0092] 100mM potassium acetate
[0093] 14mM magnesium acetate
[0094] 3mM Dithiothreitol
[0095] 5% polyethylene glycol (20000)
[0096] 2mM ATP
[0097] 20mM creatine phosphate
[0098] 100ng / μl creatine kinase
[0099] 400ng / μl E. coli recA protein
[0100] 200ng / μl E. coli SSB protein
[0101] 60ng / μl E. coli recO protein
[0102] 40ng / μl E. coli recR protein
[0103] 60ng / μl E. coli recF protein
[0104] 8 Units Bacillus subtilis DNA polymerase I
[0105] 4U / μl reverse transcriptase
[0106] 50ng / μl Endonuclease IV
[0107] 450 μM dNTPs
[0108] 420nM per upstream primer
[0109] 420nM each downstream primer
[0110] 120nM fluorescent probe
...
Embodiment 3
[0115] Select the plasmid containing the gene sequence of the conserved region of carp spring virus as the detection target through synthesis,
[0116] The upstream primer sequence is: 5'-TGGGCATCTGTCACAACAGTGTCAAATACT-3' (Seq ID No.3);
[0117] The downstream primer sequence is: 5'-TCTCGGAGCATTCCCGTACATAATTCCTTC-3'(Seq ID No.4);
[0118] The probe sequence is: 5'-AAGTGTGTGAAATGAAAGGGAACCACTC(FAM-dT)A(THF)(BHQ1-dT)TGGATCACAGATGAG(C3-SPACER)-3'.
[0119] Utilize recombinase polymerase amplification (combined with exonuclease III) method to amplify the reaction system to amplify, and construct a 25 μl amplification reaction system as follows:
[0120] 60mM tris-acetic acid buffer pH8.0
[0121] 100mM potassium acetate
[0122] 14mM magnesium acetate
[0123] 3mM Dithiothreitol
[0124] 5% polyethylene glycol (molecular weight 20000)
[0125] 2mM ATP
[0126] 20mM creatine phosphate
[0127] 100ng / μl creatine kinase
[0128] 600ng / μl phage gp32 protein
[0129] 150ng / μl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



