Method of purifying HBc-VLPs (hepatitis B virus core virus-like particles) or HBc-VLPs derivatives

A technology of derivatives and purity, applied in the field of purifying HBc-VLPs or HBc-VLPs derivatives, can solve the problems of low purity, low yield, and many steps of HBc-VLPs, achieving good repeatability, reducing production costs, time saving effect

Inactive Publication Date: 2019-01-04
INST OF PROCESS ENG CHINESE ACAD OF SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, a complete HBc-VLP purification process has been developed using chromatography technology (Expression, purification and characterization of full-length RNA-free hepatitis B coreparticles, Protein Expression and Purification, 54(2007) 30-37), but It involves ion exchange chromatography, gel filtration chromatography and affinity layer washing, with many steps and low yield, less than 10%.
However, in these studies, some impurities are usually removed by one-step heating pretreatment, followed by a subsequent chromatography step, so the purity of HBc-VLPs is still relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of purifying HBc-VLPs (hepatitis B virus core virus-like particles) or HBc-VLPs derivatives
  • Method of purifying HBc-VLPs (hepatitis B virus core virus-like particles) or HBc-VLPs derivatives
  • Method of purifying HBc-VLPs (hepatitis B virus core virus-like particles) or HBc-VLPs derivatives

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] In this example, the bacteria solution containing HBc-VLPs was prepared through the following steps

[0074] HBc-VLPs质粒构建与转化:乙肝核心抗原的核苷酸序列,SEQ ID NO.1:ATGGACATTGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCGTTTTTGCCTTCTGACTTCTTTCCTTCCGTCAGAGATCTCCTAGACACCGCCTCAGCTCTGTATCGAGAAGCCTTAGAGTCTCCTGAGCATTGCTCACCTCACCATACTGCACTCAGGCAAGCCATTCTCTGCTGGGGGGAATTGATGACTCTAGCTACCTGGGTGGGTAATAATTTGGAAGATCCAGCATCCAGGGATCTAGTAGTCAATTATGTTAATACTAACATGGGTTTAAAGATCAGGCAACTATTGTGGTTTCATATATCTTGCCTTACTTTTGGAAGAGAGACTGTACTTGAATATTTGGTCTCTTTCGGAGTGTGGATTCGCACTCCTCCAGCCTATAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGACGACGGGACCGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGCAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAG.

[0075] Its amino acid sequence SEQ ID NO.2: MDIDPYKEFGATVELLSFLPSDFFFPSVRDLLDTASALYREALESPEHCSPHHTALRQAILCWGELMTLATWVGNNLEDPASRDLVVNYVNTNMGLKIRQLLWFHISCLTFGRETVLEYLVSFGVWIRTPPAYRPPNAPILSTLPETTVVRRRDRGRSPRRRTPSQPRRRRSQSPRRRSQSRES

[0076] Through PCR amplification, the ampl...

Embodiment 2

[0083] In this embodiment, the thermal stability detection of HBc-VLPs and the determination of the heating temperature are carried out

[0084] Using DSC technology to detect the thermal stability of HBc-VLPs, such as figure 1 As shown, its denaturation temperature is 96°C. In order to make full use of the advantage of the heat resistance of HBc-VLPs, the effects of different heating temperatures and times on the removal rate of impurity proteins and the yield of target proteins were investigated. In the case of heating for 30 minutes, the heating temperature of the supernatant of cell disruption increased from When 25°C (room temperature) was increased to 80°C, the removal rate of impurity proteins increased gradually ( Figure 2A ). The heat-treated samples were purified by density gradient centrifugation to obtain pure HBc-VLPs, and then the particles were denatured with denaturants such as urea or guanidine hydrochloride to completely crack the virus-like particles and ...

Embodiment 3

[0087] In this embodiment, the secondary gradient heating is carried out, and the high performance liquid phase detection of the bacterial liquid is carried out

[0088] The broken supernatant of bacteria after heat treatment at 60° C. for 30 minutes was centrifuged at 4° C. for 15 minutes, then heat-treated at 70° C. for 30 minutes, and centrifuged at 4° C. for 20 minutes. TSK5000 high performance liquid phase size exclusion chromatography was used to analyze the protein changes in the supernatant during the two gradient heating processes. The chromatographic analysis conditions were: mobile phase: 50mM PB buffer with pH 6.8; flow rate: 0.5mL / min; : 100 μL.

[0089] The result is as image 3 As shown, the peak at the retention volume of 5.6 mL is HBc-VLPs. Comparing the broken cell supernatant before and after heat treatment at 60°C, it was found that the protein content decreased significantly after the retention volume was 11.8 mL. After further heating at 70°C for 30min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method of purifying HBc-VLPs or HBc-VLPs derivatives. The method includes: subjecting a bacterial liquid containing HBc-VLPs or HBc-VLPs derivatives to first thermal treatmentprior to second thermal treatment so as to obtain purified HBc-VLPs or HBc-VLPs derivatives. The method provided herein helps solves, via two-step gradient heating, the problem that existing universal one-step heating methods face low removal rate of miscellaneous proteins, while miscellaneous proteins may enter viral-like particles to cause product pollution; good product quality is guaranteed;the purity is high; the product purity may be increased to 99% and above by means of refining and otherness while the yield may be increased to about 77%; the method has good practical application value and industrial application value.

Description

technical field [0001] The invention belongs to the field of biochemical separation, and relates to a method for purifying HBc-VLPs or HBc-VLPs derivatives, in particular to a method for purifying HBc-VLPs or HBc-VLPs derivatives using a secondary gradient heating method. Background technique [0002] Hepatitis B virus core antigen (Hepatitis B virus core antigen, HBcAg) consists of 183 amino acids, with a relative molecular mass of 21,000 Da. When expressed in eukaryotic and prokaryotic expression systems, it can self-assemble into virus-like particles (Virus-like particles, VLPs), with a particle structure of regular icosahedral symmetry. As a kind of VLP, HBcAg not only has strong immunogenicity itself, but also can be used as a vaccine carrier, and foreign fragments can be inserted into its C-terminus, N-terminus and immunogenic region (MIR) without affecting the correctness of its assembly. . Vaccines based on HBc-VLP such as foot-and-mouth disease vaccine and malaria...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/02C12N15/36C12N15/70C12N1/21C12R1/19
CPCC07K14/005C12N15/70C12N2730/10122C12N2730/10123C12N2730/10151
Inventor张松平苏志国李正军杨延丽马光辉
OwnerINST OF PROCESS ENG CHINESE ACAD OF SCI