Method for creating non-wrapround rice two-line sterile line with CRISPR/Cas9 technology

A cas9-eui-grna and rice technology, applied in the direction of recombinant DNA technology, botany equipment and methods, biochemical equipment and methods, to speed up the breeding process, shorten the breeding cycle, and prevent gibberellin from polluting the environment

Pending Publication Date: 2019-02-05
HUNAN HYBRID RICE RES CENT
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Scholars at home and abroad have made great progress in improving rice yield, quality, resistance, fertility, plant type and other important traits by using CRISPR / Cas9 technology, such as erect dense panicle OsDEP1, large panicle OsCKX2, number of grains per panicle Gnla, and grain weight. GW, grain length GS3, aroma OsBADH2, waxy Oswaxy, rice blast OsERF922, photosensitive genic male sterile csa, thermosensitive genic male sterile TMS5, semi-dwarf OsSD1, rolling leaf ROC5, heading stage Hd1, etc., but for There is no report on the genetic disorder of neck circumcision in improved male sterile line

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating non-wrapround rice two-line sterile line with CRISPR/Cas9 technology
  • Method for creating non-wrapround rice two-line sterile line with CRISPR/Cas9 technology
  • Method for creating non-wrapround rice two-line sterile line with CRISPR/Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1, Construction of Rice EUI Gene-directed Knockout Expression Vector Based on pYLCRISPR / Cas9 System

[0031] (1) Genomic target selection; query the EUI locus number (LOC_Os05g40384) from the National Rice Data Center (http: / / www.ricedata.cn / gene / ), click on the locus number to enter (http: / / rice.plantbiology. msu.edun / ) to query the EUI gene structure, such as figure 1 As shown in A, the gene consists of two exons and one intron, the first exon is 355bp long, the second exon is 1379bp long, and the intron is 7874bp long. Then download the CDS sequences of the indica (Oryza indica) and japonica (Oryza sativa) EUI genes from the Gramene (http: / / www.gramene.org / ) database, and select the second exon of the indica and japonica EUI genes by sequence comparison A fragment of SEQ ID NO.1 with the same nucleotide sequence, which is used to translate the 356th-1018th nucleotide sequence after the initiation codon ATG; utilize the bioinformatics website (http: / / crispr.d...

Embodiment 2

[0051] Example 2, Genetic Transformation of Rice EUI Gene Targeted Knockout pYLCRISPR / Cas9 Expression Vector

[0052] The recombinant Agrobacterium pYLCRISPR / Cas9-eui-gRNA in Example 1 was used to infect the callus induced by mature embryos of the two-line male sterile line Pei'ai 64S in rice, and the obtained rice transformed plants were named L64S respectively. The specific method of the experiment is as follows :

[0053] (1) Induction of mature embryo callus: the rice seeds are dehulled, washed with water, sterilized in 75% ethanol for 5 minutes, and then sterilized in 33% sodium hypochlorite for 30-45 minutes. Wash the seeds with sterile water to remove sodium hypochlorite until there is no obvious smell. The seeds were placed on NBD2 (2,4-D concentration of 2mgL-1) medium plate, and cultured in the dark at 260C for 10-14d. After the yellow callus grew out, the induced new callus was excised with a razor blade, cultured on a new NBD2 medium for 10 days, and then used fo...

Embodiment 3

[0058] Example 3. Detection of targeted knockout of rice EUI gene and acquisition of long panicle neck male sterile line without transgenic components

[0059] (1) Positive plant identification: Get the T0 generation plant blade that embodiment 2 obtains, use CTAB method to extract genomic DNA, and use this as template, use the specific primer Hpt-F / Hpt-R of hygromycin resistance gene Hpt Carry out PCR amplification, and the PCR product is detected by agarose gel electrophoresis to detect the hygromycin resistance gene HPT marker. The genomic DNA of the positive plants transformed in the T0 generation can amplify a specific band of 697bp, and the non-positive plants cannot amplify the target strips such as figure 2 shown.

[0060] Hpt-F (SEQ ID NO. 14): ATTTGTGTACGCCCGACAGT

[0061] Hpt-R (SEQ ID NO. 15): GTGCTTGACATTGGGGAGTT

[0062] image 3It is the Hpt PCR detection result of the T0 generation knockout strain in Example 3; wherein 1-8 represent 12 different T1 generat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for breeding non-wrapround rice sterile line rice with a CRISPR / Cas9 technology. The method comprises the following steps: designing a target sequence according to an EUI (Elongated Uppermost Internode) gene coding sequence in rice, and constructing a pCRISPR / Cas9-EUI-gRNA recombinant vector containing a target sequence fragment; transforming rice callus tissue through agrobacterium to obtain a transgenic seedling; performing positive selection, sequencing analysis and transgenic element detection on the transgenic seedling to obtain a function deletion mutant free from a transgenic component. By adopting the method, an EUI gene is subjected to site-directed mutation by using the CRISPR / Cas9 technology to realize oriented creation of the non-wrapround rice two-line sterile line free from the transgenic component. The method has the advantages of high targeting efficiency, short breeding period, low cost and high practicability.

Description

technical field [0001] The invention relates to the field of plant transgenic technology and the field of crop genetic breeding, in particular to a method for site-directed mutation of rice EUI gene by using CRISPR / CAS9 technology. Background technique [0002] The research and application of hybrid rice has made great contributions to my country's food security, farmers' income increase and seed industry development. Continuously using new technologies and methods to convert cloned functional genes into molecular design breeding that breeders can use to improve heterosis and reduce seed production costs is an important direction for hybrid rice research. At present, the rice male sterile lines used in production generally have different degrees of neck wrapping when heading, which greatly restricts the outcrossing seed setting rate of male sterile lines and the yield of breeding and production. Although the method of gibberellin spraying can be applied in production to ove...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N9/22A01H5/00A01H6/46
CPCC12N9/22C12N15/8213C12N15/8261
Inventor张志刚颜应成曹孟良吕启明张志华罗孝和
OwnerHUNAN HYBRID RICE RES CENT