Deep-sea-derived strains and their encoded β-galactosidase genes and applications

A technology of galactosidase and strains, applied in the fields of application, glycosylase, genetic engineering, etc., can solve the problem of low activity and achieve the effect of broad application prospects

Active Publication Date: 2021-08-03
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most commercial β-galactosidases used in milk processing are selective mesophilic enzymes with low activity at refrigeration temperatures

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deep-sea-derived strains and their encoded β-galactosidase genes and applications
  • Deep-sea-derived strains and their encoded β-galactosidase genes and applications
  • Deep-sea-derived strains and their encoded β-galactosidase genes and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1 produces the screening of β-galactosidase bacterial strain

[0041]Take 4000m of deep sea water, respectively carry out 10 times, 100 times, 1000 times of dilution, take 100 μ L and spread it on the 2216E agar plate containing 1% lactose and X-Gal (40 μ g / mL), place the plate on 4 Cultivate in an incubator for 2 weeks. Pick the blue clones on the plate and streak to obtain a pure culture. Single clones were inoculated into 2216E liquid medium and cultured at 25°C for 2 days. The genomic DNA of the bacterial liquid was extracted, and PCR was performed with 16SrRNA universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). After the PCR product was sequenced, the 16SrRNA sequence of the strain was obtained. Blast analysis was performed on the 16SrRNA sequence of strain ML117 and the known 16SrRNA sequence in the NCBI database, and it was found that the β-galactosidase-producing strain ML117 belongs to the genus Alteromonas, and the strain...

Embodiment 2

[0051] Embodiment 2 Construction of low temperature β-galactosidase new gene expression vector

[0052] The single clone of Alteromonas sp.ML117 grown on the 2216E plate was picked and inoculated into the 2216E liquid medium, and cultured at 25°C for 2 days. Take fresh bacterial liquid to extract genomic DNA, and the extracted DNA is passed through primer 1 (CG GAATTC ATGCATACTGTGGCTG) and primer 2 (CCG CTCGAG GGCTACAGGGCAAA) to perform PCR (the underlined parts are restriction enzyme cutting sites EcoR I and Xho I, respectively) to obtain the β-galactosidase gene.

[0053] PCR system (LA Taq enzyme was purchased from TaKaRa)

[0054]

[0055] PCR conditions

[0056] 1.94℃, 5min

[0057] 2.94℃, 1min

[0058] 55℃, 30s

[0059] 72°C, 3min

[0060] Cycle 25 times

[0061] 3.72℃, 5min

[0062] The PCR product was ligated to a T vector for gene sequencing. Sequencing results revealed that the low-temperature β-galactosidase gene derived from Alteromonassp.ML117 has 3...

Embodiment 3

[0064] Embodiment 3 The preparation method of low temperature recombinant β-galactosidase

[0065] The above-mentioned recombinant plasmid was transformed into Escherichia coli BL21 (DE3) to obtain a genetically engineered strain of low-temperature β-galactosidase. The strain was inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Take 1% culture solution to inoculate and cultivate to OD 600 value 0.6, add IPTG to a final concentration of 0.2mM, and induce at 20°C for 12 hours. The cells were collected by centrifugation at 8500 rpm for 15 minutes at 4°C, and the cells were resuspended with 50 mM phosphate buffer (pH 7.3). The cells were ultrasonically disrupted, and the disrupted solution was centrifuged at 10,000 rpm for 20 minutes at 4°C, and the supernatant was the crude enzyme solution. Wash the affinity chromatography column Ni-NTA Agarose for 5 column volumes with equilibration buffer (50mM phosphate buffer, 500mM NaCl, pH 7....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a deep-sea-derived bacterial strain and its encoded β-galactosidase gene and application, belonging to the field of biotechnology. The bacterial strain is Alteromonas sp. strain ML117, which was produced in 2017 It was deposited in the China Center for Type Culture Collection on December 14, and the deposit number is CCTCC NO: M2017788. The bacterial strain contains a gene encoding a low-temperature β-galactosidase, and the low-temperature β-galactosidase has broad application prospects in the production of low-lactose milk.

Description

technical field [0001] The invention relates to the technical field of marine biology, in particular to a strain derived from deep-sea microorganisms, a low-temperature β-galactosidase coding gene, expression and application thereof. Background technique [0002] β-galactosidase (EC.3.2.1.23), also known as lactase, is a hydrolytic enzyme widely distributed in animals, plants and microorganisms, including bacteria, fungi and yeast. The enzyme can specifically hydrolyze lactose to generate galactose and glucose, and has the function of transglycosylation, using lactose or its hydrolyzed products galactose and glucose as glycosyl acceptors to synthesize galactosidic bonds and generate functional oligosaccharides. Due to their hydrolytic and transglycosylation activities, they are widely used enzymes in the food industry. Based on the hydrophobicity, amino acid sequence similarity, reaction mechanism and common domain of β-galactosidase, it belongs to the GH1, GH2, GH35, GH42 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/20C12N15/56C12N9/38C12N15/70C12N1/21A23C9/12C12R1/01C12R1/19
CPCA23C9/1206C12N9/2471C12N15/70C12Y302/01023C12N1/205C12R2001/01
Inventor孙晶晶郝建华王伟刘均忠
OwnerYELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI