Hydroxylase mutant
A hydroxylase and mutant technology, applied in the field of biocatalysis, can solve the problems of low catalytic efficiency and achieve the effect of improving catalytic activity and mild enzyme catalytic reaction conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1 Construction of wild-type DMDH and CPR2 gene co-expression plasmid
[0062] 1. The used DMDH gene SEQ ID NO: 2 (or PgPPDS) and CPR2 gene SEQ ID NO: 6 (or AtCPR2) were synthesized by Suzhou Jinweizhi Biotechnology Company, and the target gene was loaded on the pUC57 vector to obtain pUC57 respectively -DMDH and pUC57-CPR2 plasmid, used for subsequent PCR amplification template.
[0063] 2. The construction of wild-type DMDH and CPR2 gene co-expression plasmid includes the following steps:
[0064] 2.1 Using Invitrogen's vector pYES2.1 / V5-his-TOPO as a template, the following primer pair (5'-3') was used to amplify the vector fragment.
[0065] pYES2.1-vector-F:AAGCTGCGGCCCTGCATTAA,
[0066] pYES2.1-vector-R:ACGCGCCCTGTAGCGCCCCA.
[0067] 2.2 Use the following primer pairs (5'-3') to amplify the promoter TDH3p using Saccharomyces cerevisiae BY4742 genomic DNA as a template.
[0068] TDH3p-F:ctgttccagagaacccccatg gtttaaacaccctggtcgacCAGTTCGAGTTTATCATTATC,
[0069] TDH3p-cpr2...
Embodiment 2
[0088] Example 2 Construction of random mutant library of hydroxylase by error-prone PCR method
[0089] Using the plasmid pYES2.1-DMDH-CPR2 obtained in Example 1 as a template, error-prone PCR technology was used to construct a random mutant library, and the primer pairs used were as follows:
[0090] Forward primer Errorpcr-F: ATGGTTTTGTTCTTTTCTTT,
[0091] Reverse primer Errorpcr-R: AATTATGTGGATGTAAATGT.
[0092] 50μL error-prone PCR reaction system includes: 50ng plasmid template pYES2.1-DMDH-CPR2, 30pmol pair of primer Errorpcr-F and Errorpcr-R, 1X Taq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mMdTTP, 7mM MgCl 2 , (0mM, 0.05mM, 0.1mM, 0.15mM, 0.2mM) MnCl 2 , 2.5 units of Taq enzyme (Fermentas). The PCR reaction conditions were: 95°C for 5min; 94°C for 30s, 55°C for 30s, 72°C for 2min / kbp; 30 cycles; 72°C for 10min. The 1.5kb random mutant fragment was recovered by the gel as the large primer, and the MegaPrimer PCR was performed with KOD-plus DNA polymerase: 94°C 5min, 98°C 10s...
Embodiment 3
[0093] Example 3 Expression and preparation of hydroxylase
[0094] The expression host selected Saccharomyces cerevisiae BY4742MATa his3Δ1leu2Δ0met15Δ0ura3Δ0 strain. Transformation, expression and enzyme solution preparation method reference (Han, J.-Y., H.-S. Hwang, S.-W. Choi, H.-J. Kim and Y.E. Choi. Cytochrome P450 CYP716A53v2 Catalyzes the Formation of Protopanaxatriol from Protopanaxadiol During Ginsenoside Biosynthesis inPanax Ginseng.Plant Cell Physiol.2012,53(9):1535-1545.), the specific method is as follows:
[0095] The host strain BY4742 was streaked on YPD solid medium, cultured at 30°C for 2 days, and a single colony was transferred to a test tube containing 4ml YPD liquid medium. Cultivate overnight at 30°C and 220 rpm, transfer to a 250ml shake flask containing 25ml YPD liquid medium, cultivate at 30°C and 220 rpm for 4-6 hours, and cultivate to OD 600 It is 0.8~1.0, the bacterial liquid is used to prepare the transformation competence of Saccharomyces cerevisiae....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com