Supercharge Your Innovation With Domain-Expert AI Agents!

Hydroxylase mutant

A hydroxylase and mutant technology, applied in the field of biocatalysis, can solve the problems of low catalytic efficiency and achieve the effect of improving catalytic activity and mild enzyme catalytic reaction conditions

Active Publication Date: 2019-03-15
ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the catalytic efficiency of the DMD hydroxylase is low. If it is modified to greatly increase the enzyme activity, it will provide feasibility for industrial applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hydroxylase mutant
  • Hydroxylase mutant
  • Hydroxylase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Construction of wild-type DMDH and CPR2 gene co-expression plasmid

[0062] 1. The used DMDH gene SEQ ID NO: 2 (or PgPPDS) and CPR2 gene SEQ ID NO: 6 (or AtCPR2) were synthesized by Suzhou Jinweizhi Biotechnology Company, and the target gene was loaded on the pUC57 vector to obtain pUC57 respectively -DMDH and pUC57-CPR2 plasmid, used for subsequent PCR amplification template.

[0063] 2. The construction of wild-type DMDH and CPR2 gene co-expression plasmid includes the following steps:

[0064] 2.1 Using Invitrogen's vector pYES2.1 / V5-his-TOPO as a template, the following primer pair (5'-3') was used to amplify the vector fragment.

[0065] pYES2.1-vector-F:AAGCTGCGGCCCTGCATTAA,

[0066] pYES2.1-vector-R:ACGCGCCCTGTAGCGCCCCA.

[0067] 2.2 Use the following primer pairs (5'-3') to amplify the promoter TDH3p using Saccharomyces cerevisiae BY4742 genomic DNA as a template.

[0068] TDH3p-F:ctgttccagagaacccccatg gtttaaacaccctggtcgacCAGTTCGAGTTTATCATTATC,

[0069] TDH3p-cpr2...

Embodiment 2

[0088] Example 2 Construction of random mutant library of hydroxylase by error-prone PCR method

[0089] Using the plasmid pYES2.1-DMDH-CPR2 obtained in Example 1 as a template, error-prone PCR technology was used to construct a random mutant library, and the primer pairs used were as follows:

[0090] Forward primer Errorpcr-F: ATGGTTTTGTTCTTTTCTTT,

[0091] Reverse primer Errorpcr-R: AATTATGTGGATGTAAATGT.

[0092] 50μL error-prone PCR reaction system includes: 50ng plasmid template pYES2.1-DMDH-CPR2, 30pmol pair of primer Errorpcr-F and Errorpcr-R, 1X Taq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mMdTTP, 7mM MgCl 2 , (0mM, 0.05mM, 0.1mM, 0.15mM, 0.2mM) MnCl 2 , 2.5 units of Taq enzyme (Fermentas). The PCR reaction conditions were: 95°C for 5min; 94°C for 30s, 55°C for 30s, 72°C for 2min / kbp; 30 cycles; 72°C for 10min. The 1.5kb random mutant fragment was recovered by the gel as the large primer, and the MegaPrimer PCR was performed with KOD-plus DNA polymerase: 94°C 5min, 98°C 10s...

Embodiment 3

[0093] Example 3 Expression and preparation of hydroxylase

[0094] The expression host selected Saccharomyces cerevisiae BY4742MATa his3Δ1leu2Δ0met15Δ0ura3Δ0 strain. Transformation, expression and enzyme solution preparation method reference (Han, J.-Y., H.-S. Hwang, S.-W. Choi, H.-J. Kim and Y.E. Choi. Cytochrome P450 CYP716A53v2 Catalyzes the Formation of Protopanaxatriol from Protopanaxadiol During Ginsenoside Biosynthesis inPanax Ginseng.Plant Cell Physiol.2012,53(9):1535-1545.), the specific method is as follows:

[0095] The host strain BY4742 was streaked on YPD solid medium, cultured at 30°C for 2 days, and a single colony was transferred to a test tube containing 4ml YPD liquid medium. Cultivate overnight at 30°C and 220 rpm, transfer to a 250ml shake flask containing 25ml YPD liquid medium, cultivate at 30°C and 220 rpm for 4-6 hours, and cultivate to OD 600 It is 0.8~1.0, the bacterial liquid is used to prepare the transformation competence of Saccharomyces cerevisiae....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention obtains a hydroxylase mutant SEQ ID Nos:3-4 with the enzyme activity improved by means of directed evolution, the mutant or an expressed microorganism can efficiently catalyze dammarenediol to prepare protopanoxadiol through a hydroxylation reaction, and the hydroxylase mutant has industrial development and application prospects.

Description

Technical field [0001] The invention belongs to the field of biocatalysis, and relates to a mutant of hydroxylase, in particular to a mutant of dammarene glycol hydroxylase and its use in synthesizing protopanaxadiol. Background technique [0002] Ginsenosides are the general term for saponins isolated from ginseng and its genus plants (such as Panax notoginseng, American ginseng, etc.). They belong to the triterpene saponins and are the main effective ingredients in ginseng. At present, at least 60 saponins have been isolated from ginseng, some of which have been proven to have a wide range of physiological functions and medicinal values: including anti-tumor, immune regulation, anti-fatigue, heart protection, liver protection and other functions. According to the form of aglycone, ginsenosides are generally divided into three types, oleanane type, protopanaxadiol type (PPD type) and protopanaxatriol type (PPT type). Protopanaxadiol (PPD) is an important precursor for the synth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N1/19C12P33/06C12R1/865
CPCC12N9/0073C12N15/81C12P33/06
Inventor 范文超高书良王金刚梁岩袁圣伦任亮
Owner ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More