Citrus laccase family gene CsiLAC4 and application thereof

A technology of citrus and laccase, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems that have not been reported yet, and achieve the effect of improving boron toxicity resistance, good development status, and improving plant boron toxicity resistance

Inactive Publication Date: 2019-03-15
POMOLOGY RES INST FUJIAN ACAD OF AGRI SCI
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no relevant research reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Citrus laccase family gene CsiLAC4 and application thereof
  • Citrus laccase family gene CsiLAC4 and application thereof
  • Citrus laccase family gene CsiLAC4 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 citrus laccase family gene CsiLAC4 Cloning of full-length cDNA

[0037] Citrus laccase family genes CsiLAC4 Primer premier 5 .0 was used to design primers for the gene sequence of citrus, and its full-length was amplified from Citrus citrus by combining RT-PCR and nested PCR. The detailed steps are as follows:

[0038] The materials are the seedlings of 'Snow Orange' planted in the Citrus Greenhouse of the Institute of Pomology, Fujian Academy of Agricultural Sciences, with a seedling age of 11 weeks. After adding 400 μM boric acid Hoagland's nutrient solution every other day for 15 weeks of boron poisoning treatment, take the 20th - 25th adult leaves above the base (1 / 3 of the plant height), and immediately freeze them with liquid nitrogen . Total RNA was extracted by TRIzol method, the specific method is as follows:

[0039] Preparation before the experiment: use 10% (v / v) DEPC water to treat all kinds of pipette tips, centrifuge tubes, mortars and p...

Embodiment 2

[0057] Under the long-term boron poisoning stress of embodiment 2 CsiLAC4 qRT-PCR analysis of genes and their relationship with cell wall secondary metabolism

[0058] To analyze the citrus laccase family genes in boron toxicity-sensitive 'Sour Pomelo' and boron toxicity-insensitive 'Snow Mandarin' CsiLAC4 Response patterns of genes to long-term boron toxicity stress, using Real-time PCR technology for CsiLAC4 Gene expression patterns were analyzed.

[0059] Designed with Primer premier 5.0 software CsiLAC4 Genes and Reference Genes β - actin qRT-PCR specific primers, CsiLAC4 The qRT-PCR specific primer forward and reverse primer sequences are shown in SEQ ID No. 6 and SEQ ID No. 7 respectively; β - actin The qRT-PCR specific primer forward and reverse primer sequences are shown in SEQ ID No. 8 and SEQ ID No. 9, respectively.

[0060] The boron toxicity-sensitive 'sour pomelo' and boron poisoned species were extracted by TRIzol method and treated with boron-stressed Ho...

Embodiment 3

[0063] Example 3 Citrus laccase family genes CsiLAC4 Subcellular localization of genes

[0064] according to CsiLAC4 The nucleotide sequence of the gene and the vector map of pCHF3-GFP, in CsiLAC4 Bam H I and Sac I restriction sites were added before and after the gene sequence. The sequence of the restriction site is as follows:

[0065] The primer sequences with restriction sites are as follows:

[0066] SEQ ID No. 3 forward primer: C GGATCC ATGGACTCCTGGGTTCGGCTTCT, where the underlined part is the BamH I restriction site;

[0067] SEQ ID No. 10 reverse primer: C GGCGCGCC AACACTTTGGAAGATCACTTGGAGGT, where the underlined part is the Asc I restriction site.

[0068] The correct sequencing results contain CsiLAC4 The pEASY-T extraction plasmid of the gene was used as a template and amplified with primers added with restriction sites. The PCR program used was the nested PCR program in Example 1.

[0069] CsiLAC4 Two bases of AA were removed from the 3′ sequence, the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a citrus laccase family gene CsiLAC4 and application thereof and belongs to the technical field of plant genetic engineering. A method for obtaining the citrus laccase family gene CsiLAC4 comprises the following steps: extracting total RNA (Ribonucleic Acid) from citrus leaves; (2) carrying out reverse transcription on the RNA obtained in the step (1) so as to obtain cDNA (Complementary Deoxyribonucleic Acid); (3) by taking the obtained cDNA as a template, carrying out a first round of PCR (Polymerase Chain Reaction) amplification by using a forward primer F1 and a reverse primer R1; (4) by taking an amplification product of the first round as a template, carrying out nest type PCR amplification by using the forward primer F1 and a reverse primer R2, thereby obtaining the citrus laccase family gene CsiLAC4. The citrus laccase family gene CsiLAC4 is adopted to improve the boron toxin resistance of plants, and provides new gene resources for abiotic stress resistant molecule breeding of plants.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to citrus laccase family genes CsiLAC4 and its application. Background technique [0002] Boron (boron, B) is one of the indispensable trace elements for plant growth, development and sexual reproduction. However, the concentration range of boron suitable for plant growth is very narrow, so it is very prone to deficiency or poisoning. Boron toxicity usually occurs in boron-rich soils. In arid and semi-arid areas that are heavily irrigated with desalinated seawater, or in agro-ecosystems where boron-containing industrial pollutants are discharged heavily, boron toxicity is an important reason for the reduction of yield and quality of various crops. Even in boron-deficient ecological areas, inappropriate boron fertilizer application often causes boron poisoning in plants. Recent studies have shown that in the main citrus producing areas in the southeast coast of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/82A01H5/00A01H6/20A01H6/78
CPCC12N9/0061C12N15/8271C12Y110/03002
Inventor黄镜浩林雄杰胡菡青王贤达范国成
OwnerPOMOLOGY RES INST FUJIAN ACAD OF AGRI SCI