Unlock instant, AI-driven research and patent intelligence for your innovation.

Polypeptide, and production method and application thereof

A technology for use and polynucleotides, applied in the field of genetic engineering, can solve the problems of long production cycle, high cost, inability to put into large-scale production, etc., and achieve the effects of high yield and purity, high stability, and high cell adhesion properties.

Active Publication Date: 2019-04-09
SHANXI JINBO BIO PHARMA CO LTD
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Foreign research institutions have obtained milk containing human collagen by breeding mice containing human collagen genes, but the cost of production is too high and the production cycle is too long to be put into large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide, and production method and application thereof
  • Polypeptide, and production method and application thereof
  • Polypeptide, and production method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Construction and expression of recombinant human collagen polypeptide

[0066] Construction and expression of TE16C gene expression vector

[0067] 1. The full-length human collagen TE16C protein sequence used in Example 1 is the sequence shown in SEQ ID No.5, the full-length 486aa, and the corresponding gene full-length 1458bp. 针对大肠杆菌的密码子进行了密码优化(核苷酸序列:gaaaacctgtatttccagggtgaacgtggtgcaccaggttttcgtggtccggcaggtccgaatggaattccgggtgagaaaggaccggctggtgagcgtggtgcgccgggtgaacgtggagcgcctggttttcgtggcccagcaggtccgaacggtattcctggtgaaaaaggtccggcgggagagcgtggtgcaccgggtgaacgcggtgcaccgggatttcgtggtccagcaggaccgaatggtatccctggtgaaaaaggaccggcaggtgagcgtggagcgccaggtgaacgtggcgcaccgggttttcgtggaccggcaggcccgaatggtattccgggtgaaaaaggcccggcaggtgaacgtggtgccccgggtgaacgtggtgcgcctggatttcgtggcccggcaggaccgaacggtatccctggagaaaaaggtcctgcaggtgagcgcggtgcgccgggcgagcgtggtgcccctggttttcgcggtccggcaggccctaatggtattcctggagaaaaaggccctgcaggtgaacgcggagcaccgggtgagcgtggcgcacctggttttcgtggtcctgcaggcccgaacggtattccgggcgaa...

Embodiment 2

[0101] Example 2: Mass spectrometry detection of TE16C protein

[0102] experimental method

[0103]

[0104] Protein samples were treated with DTT reduction and alkylation with iodoacetamide, and then digested with trypsin overnight. The peptides obtained after enzymatic hydrolysis were desalted by C18ZipTip, mixed with matrix α-cyano-4-hydroxycinnamic acid (CHCA) and plated. Finally, matrix-assisted laser desorption ionization-time-of-flight mass spectrometer MALDI-TOF / TOF Ultraflextreme TM , Brucker, Germany for analysis (for techniques of peptide fingerprinting, please refer to: Protein J.2016; 35:212-7).

[0105] Database searches are handled from the MS / MS Ion Search page on the local mascot website. The protein identification results were obtained based on the primary mass spectrometry of the peptides produced after enzymatic digestion. Retrieval parameters: Trypsin enzymatic digestion, with two missed cut sites. Alkylation of cysteine ​​is assumed to be a fixed...

Embodiment 3

[0112] Example 3: Character detection of recombinant type III collagen

[0113] Collagen activity detection method can refer to the literature Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem.136, 643-649 (2004). The specific implementation method is as follows:

[0114] 1. Use the ultraviolet absorption method to detect the concentration of the protein samples to be tested, including control human collagen (Sigma, C7774), control old type III collagen HC16, new type III collagen TE16C protein, control T16a protein and T16b protein samples. Specifically, the ultraviolet absorption of samples at 215nm and 225nm was measured respectively, and the protein concentration was calculated by using the empirical formula C(μg / mL)=144X(A215-A225), and it should be detected under the condition of A215<1.5. The principle of this me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a polypeptide, and a production method and the application thereof, belongs to the technical field of genetic engineering, and provides the polypeptide. The polypeptide comprises n repetitions of the sequence shown in SEQ ID No.1; the n is an integer which is greater than or equal 1; when the n is the integer which is greater than or equal to 2; various repetitive sequences are directly connected with each other. The polypeptide provided by the invention has an excellent adhesion effect, has high stability in an aqueous solution, and can remove endotoxin more easily.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a polypeptide and its preparation method and application. Background technique [0002] Collagen is a type of protein widely distributed in the connective tissue of the human body, and it is also the most abundant protein in the human body, accounting for 25% to 35% of the total protein. Its main functions are reflected in maintaining the extracellular environment, maintaining the normal physiological functions of tissues and organs, and repairing body damage. Collagen is a natural biological resource. It has biohistocompatibility, support elasticity and degradability for cells, which is unmatched by other polymer materials. Therefore, collagen can be widely used in industries such as medicine and cosmetics. [0003] However, natural collagen cannot be dissolved in water, and its properties are not uniform, so it is difficult to be used by the human body. It often need...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C12N15/12C12N15/70C12N1/21C07K1/18C12R1/19
CPCC12N15/70C07K14/78C07K1/145C07K1/18
Inventor 杨霞
Owner SHANXI JINBO BIO PHARMA CO LTD