A kind of fumarase mutant and its application
A fumaric acid enzyme and mutant technology, applied in the application, enzyme, lyase and other directions, can solve the problems of difficult separation and purification, low fermentation unit, difficult industrial application, etc., to broaden the substrate reaction spectrum and application, stereoselectivity High, mild conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1 Construction of wild-type fumarase gene recombinant Escherichia coli
[0046] For the wild-type fumarase derived from Sulfolobus solfataricus P2, based on its published gene sequence (seeing literature Sonia Colombo, et.al., FEBS letters.1994,337:93-98.), the whole The gene sequence was synthesized, and restriction endonuclease sites BamHI and XhoI were designed at both ends of the gene, and subcloned into the vector pHS to obtain the wild-type gene recombinant plasmid pHS-ssFumC. Transform Escherichia coli expression host BL21(DE3) to obtain wild type fumarase recombinant Escherichia coli.
Embodiment 2
[0047] Example 2 Construction of site-directed combination mutants of fumarase
[0048]Using the plasmid pHS-ssFumC obtained in Example 1 as a template, the site-directed mutagenesis technique was used to establish a combined mutation of the four sites of threonine at position 159, methionine at position 294, lysine at position 297, and asparagine at position 299 body. According to SEQ ID NO:1 sequence, design combinatorial mutation primer pair as follows:
[0049] Forward primer 159-F:
[0050] GACGTTATCAAAAGCTGGTCGT TGC CACCTGCGTGACGCTCTGC,
[0051] Reverse primer 294-299-R:
[0052] CTGGTTCTTCTATC ATT CCGGGT ATG ACC GCG CCGGTTACCGTTGAAGCTAC.
[0053] 50μl PCR reaction system includes: 10ng pHS-ssFumC plasmid template, 10pmol primer pair, 1xKODplus buffer, 0.2mM dNTP, 1.5mM MgSO 4 , 5 units of KOD-plus DNA polymerase.
[0054] The PCR reaction conditions are: 95°C for 1min; 98°C for 10s, 57°C for 30s, 68°C for 1min / kbp; 30 cycles; 68°C for 10min. Gel recovered ...
Embodiment 3
[0057] Embodiment 3 bacterial strain shakes flask fermentation
[0058] Take a single colony of the mutant strain pHS-ssFumC-M and inoculate it into 5 ml of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) containing 50 μg / ml kanamycin sulfate , 37°C, 250rpm and cultivate overnight. Inoculate 2ml of overnight culture into 200ml TB medium, culture at 37°C, 250rpm for 2-3h, until OD 600 When the temperature is 0.6-0.8, add 0.1mM IPTG, and cultivate overnight at 28°C and 200rpm. 4°C, 10000rpm, centrifuge for 10min, and collect the bacteria.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap