A kind of fumarase mutant and its application

A fumaric acid enzyme and mutant technology, applied in the application, enzyme, lyase and other directions, can solve the problems of difficult separation and purification, low fermentation unit, difficult industrial application, etc., to broaden the substrate reaction spectrum and application, stereoselectivity High, mild conditions

Active Publication Date: 2020-07-24
ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Shenzhen Ecoman Biotechnology produced R-3HB (CN200910106660.7) by fermentation of genetically engineered E. The fermentation unit is low, the separation and purification are difficult, and it is difficult for industrial application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of fumarase mutant and its application
  • A kind of fumarase mutant and its application
  • A kind of fumarase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1 Construction of wild-type fumarase gene recombinant Escherichia coli

[0046] For the wild-type fumarase derived from Sulfolobus solfataricus P2, based on its published gene sequence (seeing literature Sonia Colombo, et.al., FEBS letters.1994,337:93-98.), the whole The gene sequence was synthesized, and restriction endonuclease sites BamHI and XhoI were designed at both ends of the gene, and subcloned into the vector pHS to obtain the wild-type gene recombinant plasmid pHS-ssFumC. Transform Escherichia coli expression host BL21(DE3) to obtain wild type fumarase recombinant Escherichia coli.

Embodiment 2

[0047] Example 2 Construction of site-directed combination mutants of fumarase

[0048]Using the plasmid pHS-ssFumC obtained in Example 1 as a template, the site-directed mutagenesis technique was used to establish a combined mutation of the four sites of threonine at position 159, methionine at position 294, lysine at position 297, and asparagine at position 299 body. According to SEQ ID NO:1 sequence, design combinatorial mutation primer pair as follows:

[0049] Forward primer 159-F:

[0050] GACGTTATCAAAAGCTGGTCGT TGC CACCTGCGTGACGCTCTGC,

[0051] Reverse primer 294-299-R:

[0052] CTGGTTCTTCTATC ATT CCGGGT ATG ACC GCG CCGGTTACCGTTGAAGCTAC.

[0053] 50μl PCR reaction system includes: 10ng pHS-ssFumC plasmid template, 10pmol primer pair, 1xKODplus buffer, 0.2mM dNTP, 1.5mM MgSO 4 , 5 units of KOD-plus DNA polymerase.

[0054] The PCR reaction conditions are: 95°C for 1min; 98°C for 10s, 57°C for 30s, 68°C for 1min / kbp; 30 cycles; 68°C for 10min. Gel recovered ...

Embodiment 3

[0057] Embodiment 3 bacterial strain shakes flask fermentation

[0058] Take a single colony of the mutant strain pHS-ssFumC-M and inoculate it into 5 ml of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) containing 50 μg / ml kanamycin sulfate , 37°C, 250rpm and cultivate overnight. Inoculate 2ml of overnight culture into 200ml TB medium, culture at 37°C, 250rpm for 2-3h, until OD 600 When the temperature is 0.6-0.8, add 0.1mM IPTG, and cultivate overnight at 28°C and 200rpm. 4°C, 10000rpm, centrifuge for 10min, and collect the bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a fumarase mutant and application thereof. The fumarase mutant of SEQ ID NO: 4 derived from Sulfolobus solfataricus P2 is obtained by a directed evolution method, the mutant or expression microorganisms thereof is capable of catalyzing a hydration reaction of crotonic acid to prepare (R)-3-hydroxybutyric acid, the product ee value exceeds 95%, and the fumarase mutant has industrial development and application prospects.

Description

technical field [0001] The invention belongs to the field of biocatalysis and relates to a fumarase mutant and its application, in particular to a fumarase mutant and its use in synthesizing R-3-hydroxybutyric acid. Background technique [0002] R-3-hydroxybutyric acid (English name is (R)-3-hydroxybutyric acid or (R)-3-hydroxybutyrate, referred to as R-3HB or R-3-HB) is a synthetic degradable material - polyhydroxyalkanoate An important monomer of PHA is also one of the important components of ketone bodies in mammals, which is closely related to energy metabolism disorders in the body, diabetes and other major diseases. The literature also reports the use of exogenous R-3HB (oral or injection) to treat some diseases and injuries. For example, Katayama et al. have reported the use of injections of R-3HB to treat the symptoms of hemorrhagic shock in mouse models; Japanese Shimizu Pharmaceutical Company Suzuki et al. In 2001, people reported the use of R-3HB in the treatment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/88C12N15/60C12N1/21C12P7/42C12R1/19
CPCC12N9/88C12P7/42C12Y402/01002
Inventor 范文超王金刚梁岩高书良任亮袁圣伦
Owner ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap