Myliataylori sesquiterpene synthetase MTa and gene sequence thereof

A technology of sesquiterpene synthase and moss moss, which is applied in genetic engineering, plant genetic improvement, lyase, etc., can solve the problems of rare plants of Caryophyllaceae and little research on moss plants

Active Publication Date: 2019-04-23
TIANJIN UNIV
View PDF8 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the special growth environment of the small calyx moss, the plants belonging to the family Caricaceae are very rare, so there

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Myliataylori sesquiterpene synthetase MTa and gene sequence thereof
  • Myliataylori sesquiterpene synthetase MTa and gene sequence thereof
  • Myliataylori sesquiterpene synthetase MTa and gene sequence thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Cloning and expression of the WQ011 / pESC-LEU-MTa bacterial strain Sesquiterpene synthase gene MT-24908

[0021] Total RNA was extracted from Lily calyx by RNAprep pure Plant Kit. The first-strand cDNA was synthesized using the Clontech SMARTer PCRcDNA Synthesis Kit, the first-strand cDNA was amplified by PCR to synthesize the second-strand cDNA, and then the double-strand DNA was amplified by secondary PCR and used for SMRTbell library construction, and PacBio ISO-Seq was used platform for sequencing.

[0022] According to the MT-24908 gene sequence SEQ ID NO.2 obtained by sequencing, primers were designed to amplify the target gene. The primer sequences are as follows:

[0023] Primer MT-24908-F: 5'CGC GGATCC ATGAATGCAGCAGGTGCATT 3' (SEQ ID NO. 3)

[0024] Primer MT-24908-R: 5'CCG CTCGAG TCATCGAGCCGATTGAGCCG 3' (SEQ ID NO. 4)

[0025] Using the cDNA sequence obtained by reverse transcription as a template, the MT-24908 gene sequence was amplified by P...

Embodiment 2

[0047] Example 2. Induced fermentation

[0048] (1) The transformant WQ011 / pESC-LEU-MTa was transferred to 50 mL of synthetic medium (with out Leu), 180 r / min, 30° C., and cultured on a shaking table for 30 h.

[0049] (2) At 30h, 10g / L galactose was added to induce expression to 90-120h, and at 36h and 72h, 10g / L ethanol was added as a supplementary carbon source.

[0050] (3) The fermentation broth was extracted with 3 mL of n-hexane for 15 min to detect by GC-MS.

Embodiment 3

[0051] Embodiment 3.GC-MS detects fermentation product

[0052] (1) GC-MS detection method

[0053] Chromatographic column: TG-5MS; Ion source; EI, 70eV; Injection volume: 1uL; Injection temperature: 200°C; Detector temperature: 280°C; Column temperature: 240°C; / min Raise the temperature to 280°C and maintain it for 5min.

[0054] (2) The output was calculated by the external standard method. Accurately prepare 0.02, 0.04, 0.06, 0.08 and 1.0mg / L standard substances respectively, take the peak area as the ordinate, and the concentration as the abscissa to draw a standard curve (such as figure 2 shown).

[0055] The results show that (such as image 3 Shown): The target peak in the GC-MS spectrum, compared with the reference mass spectrum data in the NIST14 database, it was found that the chromatographic peak of the n-hexane extract of the WQ011 / pESC-LEU-MTa strain fermentation broth at a retention time of 11.28min was orange For tertiary alcohol, the output of 50mL shake...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a myliataylori sesquiterpene synthetase MTa and a gene sequence thereof. The gene is 1,383 bp in full length and encodes 460 amino acids, the molecular weight of enzyme proteinis 52.6 KDa, pESC-LEU yeast protein expression plasmids are adopted as carriers, and Saccharomyces cerevisiae WQ011 is adopted as a host, so that heterogenous expression of the myliataylori sesquiterpene synthetase MTa is achieved. A recombinant strain WQ011/pESC-LEU-MTa can simultaneously produce two sesquiterpene alcohols, namely farnesol and nerolidol. The yields of nerolidol and farnesol in a50-mL shake flask are 1.03 mg/L and 2.00 mg/L respectively. Acquisition of the gene has profound significance on the research of sesquiterpene compounds of moss plants.

Description

technical field [0001] The invention belongs to the field of enzyme genetic engineering and enzyme engineering, and specifically relates to a sesquiterpene synthase MTa derived from Myliataylori and a gene sequence MT-24908. Background technique [0002] Terpenoids are natural products with the most complex chemical structure and conformation. There are about 80,000 terpenoids discovered so far, accounting for one-third of natural products, and they are widely distributed in plants and microorganisms. The most basic structural units required for the biosynthesis of terpenoids are Dimethylallyl diphosphate, DMAPP and Isopentenyl diphosphate, IPP comes from the mevalonate pathway and deoxyxylulose phosphate ester pathway. Different amounts of DMAPP and IPP are polymerized end-to-end and then catalyzed by a special terpene synthase to form a monoterpene (C 10 ) sesquiterpene (C 15 ) and diterpenes (C 20 ) and other natural products. Sesquiterpenoids have the most structure...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/88C12N15/60C12N15/81C12N1/19C12R1/865
CPCC12N9/88C12N15/81
Inventor 乔建军闫晓光李伟国梁冬梅
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap