Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus subtilis and its application in dissolving phosphorus and inhibiting bacteria

A technology of Bacillus subtilis and strains, applied in Bacillus subtilis and its application fields, can solve the problems of different application effects and different soil environment adaptability, and achieve the effects of broad antibacterial spectrum, increasing soluble phosphorus content, and wide application prospects

Active Publication Date: 2022-05-20
XINYANG NORMAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reported microorganisms with phosphorus-solubilizing function include Penicillium, Aspergillus, Stenotrophomonas maltophilia, Gluconacetobacter, Serratia and Bacillus, etc., all of which have shown efficient phosphorus-solubilizing effects, among which Bacillus is the most widely used bacteria. Bacillus is widely distributed in nature, has strong tolerance, and has no toxic effect on human body and plants. It is a potential good biological material. Bacillus cereus, Bacillus thuringiensis, and Bacillus megaterium all have high phosphorus-solubilizing effects. However, biological strains screened in different ecological regions have different adaptability to soil environments under different ecological conditions, and their application effects are quite different.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis and its application in dissolving phosphorus and inhibiting bacteria
  • Bacillus subtilis and its application in dissolving phosphorus and inhibiting bacteria
  • Bacillus subtilis and its application in dissolving phosphorus and inhibiting bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Isolation and screening of embodiment 1 phosphorus solubilizing bacterial strain

[0026] The materials for the isolation of phosphorus-dissolving strains were collected from tea gardens in Xinyang where tea trees have been continuously planted for many years, and the root soil of tea trees was selected for the isolation of phosphorus-dissolving strains. Weigh 1g of soil sample into a 2ml test tube, add 1ml of sterile water, mix well, and gradually dilute to 10 -6 . Take 100 μl of the bacterial suspension and spread it on the inorganic phosphorus solid medium ((NH 4 ) 2 SO 4 0.5g, MgSO 4 0.3g, NaCl 0.3g, Ca 3 (PO 4 ) 2 8.0g, glucose 10.0g, 11% MnSO 4 1 mL, 1% FeSO 4 1mL, 21g agarose, add dd H 2 0 to 1L, adjust the pH to 7.2. ) surface layer, cultivated at 37°C for 72 hours, picked a single colony with obvious phosphorus-dissolving circle, and cultured in NA medium by streaking. After the above screening, a bacterial strain WY8-7 capable of degrading ins...

Embodiment 2

[0027] The identification of embodiment 2 phosphate solubilizing strain WY8-7

[0028] (1) Morphological identification of WY8-7

[0029] WY8-7 was streak cultured in NA medium (NA medium: beef extract 3g, peptone 10g, NaCl 5g, agar powder 15g, add ddH 2 (O was fixed to 1L) surface, and observed the colony morphology after 48h. The colonies are milky white with irregular edges, rough surface, opaque, dry and wrinkled and protruding, Gram stain positive, and can form spores (such as figure 2 shown).

[0030] (2) Molecular biological identification of WY8-7

[0031] After WY8-7 was cultured in NB medium for 48 hours, the genomic DNA was extracted using tris-HCl and EDTA extraction methods, and then extracted with phenol-chloroform-isoamyl alcohol (25:24:1). Primers amplified 16S rDNA and sequenced. The length of the sequencing sequence is 1414bp, and the sequence number is SEQ ID NO.1.

[0032] Sequencing primers: 16S rDNA (forward): AGAGTTTGATCCTGGCTCAG, 16S rDNA (revers...

Embodiment 3

[0042] Example 3 Verification of Phosphorus Solubilizing Effect of Bacillus subtilis WY8-7

[0043] (1) Phosphorus-solubilizing effect analysis of strain WY8-7 under liquid shaking culture conditions

[0044] The phosphorus solubilization experiment of strain WY8-7 was carried out in inorganic phosphorus culture solution. After the WY8-7 strain was cultivated in NB medium, the bacteria were collected, washed twice with sterile water, and the concentration was adjusted to 10 8 cfu / mL, inoculated into 40mL inorganic phosphorus liquid culture solution ((NH 4 ) 2 SO 4 0.5g, MgSO 4 0.3g, NaCl 0.3g, Ca 3 (PO 4 ) 2 8.0g, glucose 10.0g, 11% MnSO 4 1 mL, 1% FeSO 4 1 mL, distilled H 2 (0 constant volume 1L, pH 7.2), with the inorganic phosphorus culture solution inoculated with the same amount of sterilized water as a control, each treatment was repeated three times. All treatments were cultured on a shaker at 37°C at 200rpm. 0 , T 3 , T 6 , T 12 , T 20 Samples were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Bacillus subtilis ( Bacillus subtilis ) WY8‑7 and its application, its deposit number is: CCTCC M 2018247. The Bacillus subtilis ( Bacillus subtilis ) Application of WY8‑7 in the degradation of insoluble inorganic phosphorus, antibacterial and plant growth promotion.

Description

technical field [0001] The invention belongs to the technical field of microbial fertilizers, and in particular relates to bacillus subtilis and applications thereof. Background technique [0002] As a large agricultural country, my country's increase in grain production is related to economic development and social stability. The large investment and use of pesticides and fertilizers has played a positive role in improving grain production. However, over the years, due to the excessive dependence on chemical fertilizers, the low utilization efficiency of chemical fertilizers, and the widespread phenomenon of irrational application, this has led to serious soil deterioration, such as compaction, acidification, decline in fertility, micro-ecological imbalance, excessive residues of harmful substances, etc. , has seriously affected the sustainable development of my country's agriculture. In order to improve soil fertility, in 2015 the Ministry of Agriculture of China put forwa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01P3/00C12R1/125
CPCC12R2001/125C12N1/205Y02A40/20
Inventor 宫安东孔宪巍吕翠华翟新可刘文德廖玉才袁红雨
Owner XINYANG NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More