Bacillus subtilis and its application in dissolving phosphorus and inhibiting bacteria
A technology of Bacillus subtilis and strains, applied in Bacillus subtilis and its application fields, can solve the problems of different application effects and different soil environment adaptability, and achieve the effects of broad antibacterial spectrum, increasing soluble phosphorus content, and wide application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Isolation and screening of embodiment 1 phosphorus solubilizing bacterial strain
[0026] The materials for the isolation of phosphorus-dissolving strains were collected from tea gardens in Xinyang where tea trees have been continuously planted for many years, and the root soil of tea trees was selected for the isolation of phosphorus-dissolving strains. Weigh 1g of soil sample into a 2ml test tube, add 1ml of sterile water, mix well, and gradually dilute to 10 -6 . Take 100 μl of the bacterial suspension and spread it on the inorganic phosphorus solid medium ((NH 4 ) 2 SO 4 0.5g, MgSO 4 0.3g, NaCl 0.3g, Ca 3 (PO 4 ) 2 8.0g, glucose 10.0g, 11% MnSO 4 1 mL, 1% FeSO 4 1mL, 21g agarose, add dd H 2 0 to 1L, adjust the pH to 7.2. ) surface layer, cultivated at 37°C for 72 hours, picked a single colony with obvious phosphorus-dissolving circle, and cultured in NA medium by streaking. After the above screening, a bacterial strain WY8-7 capable of degrading ins...
Embodiment 2
[0027] The identification of embodiment 2 phosphate solubilizing strain WY8-7
[0028] (1) Morphological identification of WY8-7
[0029] WY8-7 was streak cultured in NA medium (NA medium: beef extract 3g, peptone 10g, NaCl 5g, agar powder 15g, add ddH 2 (O was fixed to 1L) surface, and observed the colony morphology after 48h. The colonies are milky white with irregular edges, rough surface, opaque, dry and wrinkled and protruding, Gram stain positive, and can form spores (such as figure 2 shown).
[0030] (2) Molecular biological identification of WY8-7
[0031] After WY8-7 was cultured in NB medium for 48 hours, the genomic DNA was extracted using tris-HCl and EDTA extraction methods, and then extracted with phenol-chloroform-isoamyl alcohol (25:24:1). Primers amplified 16S rDNA and sequenced. The length of the sequencing sequence is 1414bp, and the sequence number is SEQ ID NO.1.
[0032] Sequencing primers: 16S rDNA (forward): AGAGTTTGATCCTGGCTCAG, 16S rDNA (revers...
Embodiment 3
[0042] Example 3 Verification of Phosphorus Solubilizing Effect of Bacillus subtilis WY8-7
[0043] (1) Phosphorus-solubilizing effect analysis of strain WY8-7 under liquid shaking culture conditions
[0044] The phosphorus solubilization experiment of strain WY8-7 was carried out in inorganic phosphorus culture solution. After the WY8-7 strain was cultivated in NB medium, the bacteria were collected, washed twice with sterile water, and the concentration was adjusted to 10 8 cfu / mL, inoculated into 40mL inorganic phosphorus liquid culture solution ((NH 4 ) 2 SO 4 0.5g, MgSO 4 0.3g, NaCl 0.3g, Ca 3 (PO 4 ) 2 8.0g, glucose 10.0g, 11% MnSO 4 1 mL, 1% FeSO 4 1 mL, distilled H 2 (0 constant volume 1L, pH 7.2), with the inorganic phosphorus culture solution inoculated with the same amount of sterilized water as a control, each treatment was repeated three times. All treatments were cultured on a shaker at 37°C at 200rpm. 0 , T 3 , T 6 , T 12 , T 20 Samples were...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com