Cedar synthase Lc-CedS encoding gene and application thereof
A technology that encodes genes and cedrol, applied in the field of synthetic biology, can solve problems that have not been reported in the literature, and achieve the effect of solving source and resource problems and enriching diversity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Acquisition and bioinformatics analysis of the cDNA sequence of the gene encoding cedrol synthase Lc-CedS:
[0035] For the RNA extraction of rice ball flowers, see the molecular cloning manual for the operation steps, to obtain RNA, use SMART TM The primers 5'-CDS primer, SMARTIITM A oligonucleotide, and 3'-CDS primer in the RACE cDNA Amplification Kit kit were reverse-transcribed to synthesize cDNA, and cDNA was synthesized by 3'RACE-in (CCACGATTTGTTCGCCACTTCACTT) and 3'RACE-out (AGCGTTTGGGACTGGCGTATCATTTTG) , and 5'RACE-in (AATGATACGCCAGTCCCAAACGCT) and 5'RACE-out (GTTGCGTAAATGGGAATAAAAATGAGTGC) were used as primers for PCR amplification to obtain the full-length cDNA sequence of Lc-CedS gene (such as Seq ID No.2).
[0036] The open reading frame (ORF) of cedrol synthase Lc-CedS is 1650bp (Seq ID No.2), encodes 549 amino acids (Seq ID No.1), and the molecular weight is 63kDa. The cedrol synthase Lc-CedS gene The encoded amino acid sequence contains typical DDXXD an...
Embodiment 2
[0038] Cedrol synthase Lc-CedS encoding gene cDNA sequence expression vector construction:
[0039] For the extraction of RNA from orchid flowers, please refer to the molecular cloning manual for the operation steps, to obtain RNA, use SMART TM The primer 5'-CDS primer in the RACE cDNA Amplification Kit kit was reverse-transcribed to synthesize cDNA as a template, the above-mentioned Lc-CedSF and Lc-CedSR were used as primers, and the high-fidelity enzyme PrimeSTAR HS DNA Polymerase was used for PCR amplification. The PCR system was 50 μL. The reaction program is: 5×PrimeSTAR HS Buffer 10μL, dNTP Mixture (2.5mM each) 4μL, Primer F 1μL, Primer R 1μL, Template 0.5μL, PrimeSTAR HS DNA Polymerase 0.5μL, ddH2 O to make up to 50 μL. The PCR program was: 98°C for 10 sec, 60°C for 15 sec, 72°C for 2 min, 35 cycles. After the program was completed, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. At the same time, the pCold TF ...
Embodiment 3
[0041] Protein-induced expression and solubility analysis of cedrol synthase Lc-CedS:
[0042] The recombinant pCold TF / Lc-CedS strain with correct sequencing was picked to extract the plasmid, and the plasmid was transformed into the expression strain Rosetta (DE3). The LB solid plate was screened, and a single clone was randomly selected for colony PCR verification. The verified correct single clone was inoculated in 6 ml of LB liquid medium containing ampicillin and chloramphenicol resistance, and cultured overnight at 37°C with shaking. The activated bacteria were inoculated into 100mL LB liquid medium at a ratio of 1:100, and cultured with shaking at 37°C until OD 600 The value is around 0.5. Take 5 mL of bacterial liquid as a control, add 95 μL of 0.3 mM IPTG to the rest, and induce overnight at 16°C. Prepare related protein purification buffer, centrifuge the low-temperature-induced bacterial liquid at 4°C, 12000rpm for 10min, discard the supernatant, add 7mL buffer1 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap