Check patentability & draft patents in minutes with Patsnap Eureka AI!

Cedar synthase Lc-CedS encoding gene and application thereof

A technology that encodes genes and cedrol, applied in the field of synthetic biology, can solve problems that have not been reported in the literature, and achieve the effect of solving source and resource problems and enriching diversity

Active Publication Date: 2019-05-10
KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The important biological activity and complex tricyclic skeleton of cedrol have attracted attention in chemical synthesis, biotransformation and drug delivery system, but the cedrol synthase encoding gene responsible for the key step of cedrol biosynthesis and its application have not been reported in the literature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cedar synthase Lc-CedS encoding gene and application thereof
  • Cedar synthase Lc-CedS encoding gene and application thereof
  • Cedar synthase Lc-CedS encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Acquisition and bioinformatics analysis of the cDNA sequence of the gene encoding cedrol synthase Lc-CedS:

[0035] For the RNA extraction of rice ball flowers, see the molecular cloning manual for the operation steps, to obtain RNA, use SMART TM The primers 5'-CDS primer, SMARTIITM A oligonucleotide, and 3'-CDS primer in the RACE cDNA Amplification Kit kit were reverse-transcribed to synthesize cDNA, and cDNA was synthesized by 3'RACE-in (CCACGATTTGTTCGCCACTTCACTT) and 3'RACE-out (AGCGTTTGGGACTGGCGTATCATTTTG) , and 5'RACE-in (AATGATACGCCAGTCCCAAACGCT) and 5'RACE-out (GTTGCGTAAATGGGAATAAAAATGAGTGC) were used as primers for PCR amplification to obtain the full-length cDNA sequence of Lc-CedS gene (such as Seq ID No.2).

[0036] The open reading frame (ORF) of cedrol synthase Lc-CedS is 1650bp (Seq ID No.2), encodes 549 amino acids (Seq ID No.1), and the molecular weight is 63kDa. The cedrol synthase Lc-CedS gene The encoded amino acid sequence contains typical DDXXD an...

Embodiment 2

[0038] Cedrol synthase Lc-CedS encoding gene cDNA sequence expression vector construction:

[0039] For the extraction of RNA from orchid flowers, please refer to the molecular cloning manual for the operation steps, to obtain RNA, use SMART TM The primer 5'-CDS primer in the RACE cDNA Amplification Kit kit was reverse-transcribed to synthesize cDNA as a template, the above-mentioned Lc-CedSF and Lc-CedSR were used as primers, and the high-fidelity enzyme PrimeSTAR HS DNA Polymerase was used for PCR amplification. The PCR system was 50 μL. The reaction program is: 5×PrimeSTAR HS Buffer 10μL, dNTP Mixture (2.5mM each) 4μL, Primer F 1μL, Primer R 1μL, Template 0.5μL, PrimeSTAR HS DNA Polymerase 0.5μL, ddH2 O to make up to 50 μL. The PCR program was: 98°C for 10 sec, 60°C for 15 sec, 72°C for 2 min, 35 cycles. After the program was completed, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. At the same time, the pCold TF ...

Embodiment 3

[0041] Protein-induced expression and solubility analysis of cedrol synthase Lc-CedS:

[0042] The recombinant pCold TF / Lc-CedS strain with correct sequencing was picked to extract the plasmid, and the plasmid was transformed into the expression strain Rosetta (DE3). The LB solid plate was screened, and a single clone was randomly selected for colony PCR verification. The verified correct single clone was inoculated in 6 ml of LB liquid medium containing ampicillin and chloramphenicol resistance, and cultured overnight at 37°C with shaking. The activated bacteria were inoculated into 100mL LB liquid medium at a ratio of 1:100, and cultured with shaking at 37°C until OD 600 The value is around 0.5. Take 5 mL of bacterial liquid as a control, add 95 μL of 0.3 mM IPTG to the rest, and induce overnight at 16°C. Prepare related protein purification buffer, centrifuge the low-temperature-induced bacterial liquid at 4°C, 12000rpm for 10min, discard the supernatant, add 7mL buffer1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a cedar synthase Lc-CedS for producing cedar camphor, an encoding gene of the cedar synthase Lc-CedS and application of the cedar synthase Lc-CedS. Starting from Leucosceptrumcanum, cloning and functional authenticating are conducted on an encoding gene of a terpene synthase Lc-CedS for synthesizing the cedar campho, the encoding gene has the nucleotide sequence shown in Seq ID No.2 and is connected with different expression carriers to construct recombinant plasmids capable of being expressed in escherichia coli and tobacco, the recombinant plasmids are transferred into the escherichia coli and tobacco to construct an engineering cell, and the cedar camphor is heterogeneously synthesized from the escherichia coli and tobacco. The cedar camphor has important application value. The constructed gene engineering cell is safe, stable and short in production cycle and has great value in application and development.

Description

Technical field: [0001] The technology of the invention belongs to the field of synthetic biology, and specifically relates to a terpene synthase Lc-CedS for producing a sesquiterpene compound-cedrol (cedrol), its encoding gene and its application. Background technique: [0002] Terpenoids have various structures and are widely used, and have a wide range of biological functions and pharmacological effects. Sesquiterpenes are an important part of terpenoids, which are widely found in higher plants and microorganisms and have important biological activities, such as anti-tumor, anti-inflammatory, immunosuppressive, nervous system, antibacterial and insect-feeding activities. . In addition, the aromaticity and flammability of sesquiterpenes also have potential applications in biofuels, spices, and food and cosmetic additives. [0003] Cedrol, also known as cedrol, is widely found in the volatile oils of various plants such as Cupressaceae, Pinaceae and Pinaceae, and is a kin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12N15/82A01H5/00A01H6/82C12P15/00C12R1/19
CPCY02A50/30
Inventor 黎胜红刘燕罗菲凌伊刘艳春
Owner KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More