Mylia taylori gray sesquiterpene synthetase MTc and gene sequence thereof

A technology of sesquiterpene synthase and moss moss, which is applied in genetic engineering, plant gene improvement, lyase, etc., can solve the problems of rare plants of Caryophyllaceae and little research on moss plants

Active Publication Date: 2019-06-04
TIANJIN UNIV
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the special growth environment of the small calyx moss, the plants belonging to the family Caricaceae are very rare, so there are few studies on this kind of moss plants, and there is no relevant literature on the sesquiterpene synthase in the small calyx moss

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mylia taylori gray sesquiterpene synthetase MTc and gene sequence thereof
  • Mylia taylori gray sesquiterpene synthetase MTc and gene sequence thereof
  • Mylia taylori gray sesquiterpene synthetase MTc and gene sequence thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Cloning and expression of the WQ011 / pESC-LEU-MTc bacterial strain Sesquiterpene synthase gene MT-48190

[0021] Total RNA was extracted from Lily calyx by RNAprep pure Plant Kit. The first-strand cDNA was synthesized using the Clontech SMARTer PCRcDNA Synthesis Kit, the first-strand cDNA was amplified by PCR to synthesize the second-strand cDNA, and then the double-strand DNA was amplified by secondary PCR and used for SMRTbell library construction, and PacBio ISO-Seq was used platform for sequencing.

[0022] According to the MT-48190 gene sequence SEQ ID NO.2 obtained by sequencing, primers were designed to amplify the target gene. The primer sequences are as follows:

[0023] Primer MT-48190-F: 5'CGC GGATCC ATGCCATCGCAATATATTAT 3' (SEQ ID NO. 3)

[0024] Primer MT-48190-R: 5'CCG CTCGAG TCATGCAATGCTAACTTGGA 3' (SEQ ID NO. 4)

[0025] Using the cDNA sequence obtained by reverse transcription as a template, the MT-48190 gene sequence was amplified by P...

Embodiment 2

[0047] Example 2. Induced fermentation

[0048] (1) The transformant WQ011 / pESC-LEU-MTc was transferred to 50 mL of synthetic medium (with out Leu), 180 r / min, 30° C., and cultured on a shaking table for 30 h.

[0049] (2) At 30h, 10g / L galactose was added to induce expression to 90-120h, and at 36h and 72h, 10g / L ethanol was added as a supplementary carbon source.

[0050] (3) The fermentation broth was extracted with 3 mL of n-hexane for 15 min to detect by GC-MS.

Embodiment 3

[0051] Embodiment 3.GC-MS detects fermentation product

[0052] (1) GC-MS detection method

[0053] Chromatographic column: TG-5MS; Ion source; EI, 70eV; Injection volume: 1uL; Injection temperature: 200°C; Detector temperature: 280°C; Column temperature: 240°C; / min Raise the temperature to 280°C and maintain it for 5min.

[0054] (2) The output was calculated by the external standard method. Accurately prepare 0.02, 0.04, 0.06, 0.08 and 1.0mg / L standard substances respectively, take the peak area as the ordinate, and the concentration as the abscissa to draw a standard curve (such as figure 2 shown).

[0055] The results show that (such as image 3 Shown): The target peak in the GC-MS spectrum. After comparing with the reference mass spectrum data in the NIST14 database, it was found that the chromatographic peak of the n-hexane extract of the WQ011 / pESC-LEU-MTc strain fermentation broth at a retention time of 11.31min was orange The output of tertiary alcohol in 50mL ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses mylia taylori gray sesquiterpene synthetase MTc and a gene sequence thereof. The gene is 1032 bp in length and encodes 343 amino acids. The molecular weight of the enzyme protein is 39.5KDa. The pESC-LEU yeast protein expression plasmid is used as the vector, and Saccharomyces cerevisiae WQ011 is used as the host. Heterologous expression of the mylia taylori gray sesquiterpene synthetase MTc is realized. The recombinant strain WQ011 / pESC-LEU-MTc can simultaneously produce two sesquiterpene alcohols, namely farnesol and nerolidol. The yield of a 50 mL shake flask is 19.88 mg / L of nerolidol and 4.81 mg / L of farnesol. The acquisition of the gene has far-reaching significance for the study of sesquiterpenoid in moss plants.

Description

technical field [0001] The invention belongs to the field of enzyme genetic engineering and enzyme engineering, and specifically relates to a sesquiterpene synthase MTc derived from Myliataylori and a gene sequence MT-48190. Background technique [0002] Terpenoids are natural products with the most complex chemical structure and conformation. There are about 80,000 terpenoids discovered so far, accounting for one-third of natural products, and they are widely distributed in plants and microorganisms. The most basic structural units required for the biosynthesis of terpenoids are Dimethylallyl diphosphate, DMAPP and Isopentenyl diphosphate, IPP comes from the mevalonate pathway and deoxyxylulose phosphate ester pathway. Different amounts of DMAPP and IPP are polymerized end-to-end and then catalyzed by a special terpene synthase to form a monoterpene (C 10 ) sesquiterpene (C 15 ) and diterpenes (C 20 ) and other natural products. Sesquiterpenoids have the most structure...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/81C12N1/19C12R1/865
Inventor乔建军闫晓光李伟国梁冬梅
OwnerTIANJIN UNIV