A kind of ear1 protein related to plant drought resistance, its coding gene and application

A drought resistance, protein amino acid technology, applied in the field of genetic engineering, can solve the problem of no gene with PP2C protein phosphatase activity found, and achieve the effects of small genome, simple genetic operation and short growth cycle

Active Publication Date: 2020-11-17
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the research of the prior art, except for the ABA receptors PYR / PYLs / RCARs, no gene that can directly regulate the phosphatase activity of PP2C protein has been found.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ear1 protein related to plant drought resistance, its coding gene and application
  • A kind of ear1 protein related to plant drought resistance, its coding gene and application
  • A kind of ear1 protein related to plant drought resistance, its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction, Identification and Phenotype Analysis of CRISPR / Cas9 Gene Editing Mutants

[0031] (1) Construction of CRISPR / Cas9 gene editing vector

[0032] In order to study the molecular mechanism of plant drought resistance, the present invention utilizes CRISPR / Cas9 technology to directionally mutate the EAR1 gene from the Arabidopsis genome. First log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen the target. In order to improve the efficiency of gene editing, dual-target editing is adopted, and the sequence is as follows: the underlined area is the gene reading frame, and the italicized part is the target site.

[0033] atgtctcattctcatccatcaaaccacaatacacacttcttctcttaacaacacaacacaactttgaatttttcaccctcactttcatttatctcaaatctccttccaggtatgttacatctctagaaaacgatcacaatccaattaataacaagagataatcattcatttgtttgctaacactttgattgttataaattgtgcagaaaagcgagggaatagtgttgttgagaggtttgtgatttccttttgaaaaa atgatggcttgtggcttaagcaagagccttggcttgtct ...

Embodiment 2

[0055] Example 2 Obtaining and phenotypic analysis of ear1 mutant induced by EMS

[0056] (1) Obtaining and identification of ear1 mutant induced by EMS

[0057] The Colombian ecotype Arabidopsis seeds were subjected to EMS mutagenesis as follows: 2 O Soak the seeds overnight and remove the unsaturated seeds above. 100mM HPO in 40mL 4 2- , H 2 PO 4 - Add 160 μL of methyl methanesulfonate (EMS) to the potassium buffer solution, mix well, pour into the tube containing the seeds, mutagenize for 8 hours, wash with sodium thiosulfate 5 times to inactivate EMS, and then use ddH 2 O rinse the seeds 20 times. The mutagenized seeds were screened to finally obtain a point-mutated ear1 mutant. DNA was extracted for sequencing, and it was found that a mutation from C to T occurred at the 163rd nucleotide, which led to premature termination of translation. ( figure 2 A).

[0058] In addition to the 163rd nucleotide, mutations at other sites of the EAR1 gene may also affect the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of genetic engineering, and specifically discloses an EAR1 protein related to plant drought resistance and a coding gene thereof, and applications of the EAR1 protein and the coding gene. The EAR1 protein has the amino acid sequence shown in SEQ ID No.1, and the coding gene has the nucleotide sequence shown in SEQ ID No.2. A mutant ear1 of the gene grows better under drought treatment than that of the wild type, and has the water loss rate lower than that of the wild type, so as to indicate that the drought resistance of the mutant is significantly improved.The functional protein coded by the arabidopsis thaliana EAR1 gene is found out. The activity of PP2C can be enhanced by direct interaction with PP2C, an ABA signal pathway can be negatively regulated, and the functional protein has sequence conservativeness in dicotyledon and monocotyledon plants. As a model plant, the arabidopsis thaliana has a short growth cycle, small genome, complete sequencing and simple genetic manipulation. By a method of infecting inflorescence with agrobacterium tumefaciens, a drought-resistant overexpression plant or gene editing mutant can be obtained, and geneticresources can be provided for variety improvement.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to an EAR1 protein related to plant drought resistance, its coding gene and its application. Background technique [0002] Abiotic stresses such as drought, high temperature, low temperature, and high salinity seriously affect plant growth and development, leading to a decline in crop yield. With the global climate change, the problem of drought is becoming more and more serious. The area of ​​arid and semi-arid cultivated land accounts for 43% of the world's total cultivated land area, and our country's total cultivated land area reaches 52%. Drought is a worldwide problem restricting agricultural production, and the crop loss caused by it ranks first among abiotic stresses, second only to the losses caused by diseases and insect pests among biotic stresses. Although some plants have evolved mechanisms to adapt to drought stress, most important crops are still sensit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82
Inventor 巩志忠何俊娜王瑜王凯
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap