A kind of ear1 protein related to plant drought resistance, its coding gene and application
A drought resistance, protein amino acid technology, applied in the field of genetic engineering, can solve the problem of no gene with PP2C protein phosphatase activity found, and achieve the effects of small genome, simple genetic operation and short growth cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction, Identification and Phenotype Analysis of CRISPR / Cas9 Gene Editing Mutants
[0031] (1) Construction of CRISPR / Cas9 gene editing vector
[0032] In order to study the molecular mechanism of plant drought resistance, the present invention utilizes CRISPR / Cas9 technology to directionally mutate the EAR1 gene from the Arabidopsis genome. First log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen the target. In order to improve the efficiency of gene editing, dual-target editing is adopted, and the sequence is as follows: the underlined area is the gene reading frame, and the italicized part is the target site.
[0033] atgtctcattctcatccatcaaaccacaatacacacttcttctcttaacaacacaacacaactttgaatttttcaccctcactttcatttatctcaaatctccttccaggtatgttacatctctagaaaacgatcacaatccaattaataacaagagataatcattcatttgtttgctaacactttgattgttataaattgtgcagaaaagcgagggaatagtgttgttgagaggtttgtgatttccttttgaaaaa atgatggcttgtggcttaagcaagagccttggcttgtct ...
Embodiment 2
[0055] Example 2 Obtaining and phenotypic analysis of ear1 mutant induced by EMS
[0056] (1) Obtaining and identification of ear1 mutant induced by EMS
[0057] The Colombian ecotype Arabidopsis seeds were subjected to EMS mutagenesis as follows: 2 O Soak the seeds overnight and remove the unsaturated seeds above. 100mM HPO in 40mL 4 2- , H 2 PO 4 - Add 160 μL of methyl methanesulfonate (EMS) to the potassium buffer solution, mix well, pour into the tube containing the seeds, mutagenize for 8 hours, wash with sodium thiosulfate 5 times to inactivate EMS, and then use ddH 2 O rinse the seeds 20 times. The mutagenized seeds were screened to finally obtain a point-mutated ear1 mutant. DNA was extracted for sequencing, and it was found that a mutation from C to T occurred at the 163rd nucleotide, which led to premature termination of translation. ( figure 2 A).
[0058] In addition to the 163rd nucleotide, mutations at other sites of the EAR1 gene may also affect the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



