Supercharge Your Innovation With Domain-Expert AI Agents!

Ganoderma enigmaticum new strain and artificial cultivation method and application thereof

A cultivation method and technology of Ganoderma lucidum are applied in the field of rare medicinal bacteria new strains and artificial cultivation fields thereof, which can solve the problems such as not being applied, and achieve the effects of good domestication conversion rate and obvious effect.

Active Publication Date: 2019-07-12
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Modern pharmacological and clinical research results also show that Ganoderma lucidum contains active ingredients that inhibit tumors and regulate immunity, but it has not been practically applied in this regard

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ganoderma enigmaticum new strain and artificial cultivation method and application thereof
  • Ganoderma enigmaticum new strain and artificial cultivation method and application thereof
  • Ganoderma enigmaticum new strain and artificial cultivation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Mysterious Ganoderma Ganoderma enigmaticum

[0059] In April 2016, Wang Lusheng collected a Ganoderma lucidum specimen in Rudewa Ward, Kilosa District, Morogoro Region near the capital of Tanzania (coordinates: 6°37’28” south latitude, 37°9’1” east longitude), as figure 1 shown. The pure culture of PDA was obtained by the research staff of the Edible Fungi Research and Development Center of the Guangdong Institute of Microbiology. The pure culture of PDA was obtained by the tissue separation method. The mycelia were collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and used Ezup column fungal genome The DNA extraction kit is used to extract the DNA genome, and the obtained DNA solution is refrigerated at -20°C for later use. The ITS-PCR experiment of the material was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the ...

Embodiment 2

[0070] One, culture medium (by weight percentage):

[0071] 1. Tissue separation medium (comprehensive PDA):

[0072] Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.

[0073] 2. Mother seed medium (Red Bengal medium):

[0074] 0.5% peptone, 1% glucose, 0.1% potassium dihydrogen phosphate, magnesium sulfate (MgSO 4 ·7H 2 O) 0.05%, agar 2%, 1 / 3000 Bengal red solution 10%, chloramphenicol 0.01%, and the rest is water.

[0075] 3. Production medium of mother species (enriched with comprehensive PDA):

[0076] Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.

[0077] 4. Production medium:

[0078] 98-99% sorghum, 1-2% calcium carbonate.

[0079] 5. Cultivation material:

[0080] 38% cottonseed hulls, 50% wood chips, 10% bran, 2% CaCO 3 , the moisture of the cultivation material is 60%-65%,...

Embodiment 3

[0100] Ganoderma lucidum crude polysaccharides and ganoderma triterpenes were detected on the fruiting bodies of the mysterious new ganoderma strain CCTCC NO:M 2019093 cultivated in Example 2. Among them, the total triterpenes were determined by the oleanolic acid method, and the ganoderma acid A was determined by the high performance liquid phase method.

[0101] 1. Detection of Ganoderma lucidum crude polysaccharide

[0102] The extraction of crude polysaccharides was carried out according to NY / T1676-2008 determination method of crude polysaccharides in edible fungi. Methods as below:

[0103] 1. Preparation of glucose standard curve

[0104] Accurately weigh 50mg of standard glucose dried at 105°C with constant weight, put it in a 500ml volumetric flask, add distilled water to dissolve and dilute to the mark. Draw glucose standard solutions 0.00ml, 0.20ml, 0.40ml, 0.60ml, 0.80ml, 1.00ml, put them in colorimetric tubes with stoppers, add distilled water to the volume of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rare medicinal fungus new strain and an artificial cultivation method and application thereof, in particular to a ganoderma enigmaticum new strain and an artificial cultivation method and application thereof. The ganoderma enigmaticum new strain is derived from Tanzania, and named as ganoderma enigmaticum HMGIM-I160004, and the preservation number of the ganoderma enigmaticum is CCTCC NO:M 2019093. To sum up, the ganoderma enigmaticum new strain and the artificial cultivation method thereof have the advantages that the domestication conversion rate is high, the average mushroom bag yield is 60.88 g, the first-batch biotransformation rate is 18% or above, and the new strain is resistant to high temperature in the cultivation process; meanwhile, the new strain hasan obvious in-vitro tumor inhibition effect and a development prospect.

Description

technical field [0001] The invention relates to a new rare medicinal fungus strain and its artificial cultivation method and application, in particular to a mysterious ganoderma new strain and its artificial cultivation method and application. Background technique [0002] At present, the industry of edible and medicinal fungi is developing rapidly. According to statistics from the China Edible Fungi Association, the output of edible and medicinal fungi in my country reached 37.12 million tons in 2017, an increase of 3.21% over 2016, and the output value was 272.192 billion yuan. % and more than 20 million employees. The edible fungus industry ranks fifth in the planting industry after grain, vegetables, fruit and oil, surpassing tea and sericulture. [0003] Today, with the vigorous development of the edible and medicinal mushroom industry, more and more rare edible and medicinal mushroom varieties have gradually entered people's field of vision. Morels etc. However, ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14A01G18/00C12R1/645
CPCC12N1/14A01G18/00C12R2001/645C12N1/145
Inventor 胡惠萍吴清平刘远超谢意珍莫伟鹏卓丽君张智
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More