Ganoderma enigmaticum new strain and artificial cultivation method and application thereof
A cultivation method and technology of Ganoderma lucidum are applied in the field of rare medicinal bacteria new strains and artificial cultivation fields thereof, which can solve the problems such as not being applied, and achieve the effects of good domestication conversion rate and obvious effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Mysterious Ganoderma Ganoderma enigmaticum
[0059] In April 2016, Wang Lusheng collected a Ganoderma lucidum specimen in Rudewa Ward, Kilosa District, Morogoro Region near the capital of Tanzania (coordinates: 6°37’28” south latitude, 37°9’1” east longitude), as figure 1 shown. The pure culture of PDA was obtained by the research staff of the Edible Fungi Research and Development Center of the Guangdong Institute of Microbiology. The pure culture of PDA was obtained by the tissue separation method. The mycelia were collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and used Ezup column fungal genome The DNA extraction kit is used to extract the DNA genome, and the obtained DNA solution is refrigerated at -20°C for later use. The ITS-PCR experiment of the material was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the ...
Embodiment 2
[0070] One, culture medium (by weight percentage):
[0071] 1. Tissue separation medium (comprehensive PDA):
[0072] Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.
[0073] 2. Mother seed medium (Red Bengal medium):
[0074] 0.5% peptone, 1% glucose, 0.1% potassium dihydrogen phosphate, magnesium sulfate (MgSO 4 ·7H 2 O) 0.05%, agar 2%, 1 / 3000 Bengal red solution 10%, chloramphenicol 0.01%, and the rest is water.
[0075] 3. Production medium of mother species (enriched with comprehensive PDA):
[0076] Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.
[0077] 4. Production medium:
[0078] 98-99% sorghum, 1-2% calcium carbonate.
[0079] 5. Cultivation material:
[0080] 38% cottonseed hulls, 50% wood chips, 10% bran, 2% CaCO 3 , the moisture of the cultivation material is 60%-65%,...
Embodiment 3
[0100] Ganoderma lucidum crude polysaccharides and ganoderma triterpenes were detected on the fruiting bodies of the mysterious new ganoderma strain CCTCC NO:M 2019093 cultivated in Example 2. Among them, the total triterpenes were determined by the oleanolic acid method, and the ganoderma acid A was determined by the high performance liquid phase method.
[0101] 1. Detection of Ganoderma lucidum crude polysaccharide
[0102] The extraction of crude polysaccharides was carried out according to NY / T1676-2008 determination method of crude polysaccharides in edible fungi. Methods as below:
[0103] 1. Preparation of glucose standard curve
[0104] Accurately weigh 50mg of standard glucose dried at 105°C with constant weight, put it in a 500ml volumetric flask, add distilled water to dissolve and dilute to the mark. Draw glucose standard solutions 0.00ml, 0.20ml, 0.40ml, 0.60ml, 0.80ml, 1.00ml, put them in colorimetric tubes with stoppers, add distilled water to the volume of ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com