Method for positioning and synthesizing terpenoids by means of Yarrowia lipolytica way

A technology for Yarrowia lipolytica and terpenoid compounds, which is applied in the fields of microbial technology and fermentation engineering, can solve problems such as low theoretical yield, and achieve the effects of reducing environmental pollution, increasing yield, and increasing application added value.

Active Publication Date: 2019-08-09
SHANDONG UNIV
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the defect of low theoretical yield in the process of Yarrowia lipolytica producing mevalonate and downstream terpenoids through aerobic fermentation of glycolysis pathway, the present invention provides a method for targeted synthesis using Yarrowia lipolytica pathway The terpenoid approach

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for positioning and synthesizing terpenoids by means of Yarrowia lipolytica way
  • Method for positioning and synthesizing terpenoids by means of Yarrowia lipolytica way
  • Method for positioning and synthesizing terpenoids by means of Yarrowia lipolytica way

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Construction of Yarrowia lipolytica Engineering Strain MP1 Positioning and Expressing Mevalonate Synthetic Pathway in Peroxisomes

[0040] 1.1 Construction of expression vector

[0041] (1) Before the stop codon of the HMGR gene (AM902716.1) from Bordetella, an enhanced peroxisome localization signal ePTS1 (nine amino acid sequence of LGRGRSKL at the carboxyl end of the protein) sequence was added, and the gene HMGR was named - ePTS1 (SEQ No.1), synthesized by General Biosystems (Anhui) Co., Ltd. after codon optimization. And at the same time design primers according to the expression vector pKi-1 sequence:

[0042] HMGR-ePTS1-F:

[0043] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAGAA

[0044] HMGR-ePTS1-R:

[0045] ACATAACTAATTACATGATTTTTACAGCTTGGATCGTCGTC

[0046] Using the codon-optimized HMGR-ePTS1 gene sequence as a template, use HMGR-ePTS1-F / HMGR-ePTS1-R primer PCR (polymerase chain reaction) to amplify the HMGR-ePTS1 assembly fragment carrying the corres...

Embodiment 2

[0082] Example 2 Construction of the Yarrowia lipolytica control engineering strain M1 expressing the mevalonate pathway in the cytoplasm

[0083] 2.1 Construction of expression vector

[0084] (1) Design primers according to the gene sequence of optimized and synthesized HMGR-ePTS1 and at the same time according to the expression vector pKi-1 sequence:

[0085] HMGR-F:

[0086] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAGAA

[0087] HMGR-R:

[0088] ACATAACTAATTACATGATTTTAGCCCTGACCTCGGAGTCGAG

[0089] Using the HMGR-ePTS1 gene sequence synthesized by codon optimization as a template, HMGR-F / HMGR-R primers were used to amplify by PCR (polymerase chain reaction) to obtain HMGR assembly fragments carrying corresponding terminal homologous sequences. PCR reaction conditions: pre-denaturation at 97°C for 5min, denaturation at 94°C for 60s, annealing at 56°C for 30s, extension at 72°C for 3min, extension at 72°C for 10min after 30 cycles, and storage at 4°C.

[0090] After pKi-1 was...

Embodiment 3

[0113] Example 3 The comparison of engineering strain MP1 and M1 producing mevalonate efficiency

[0114]Engineering strains: Yarrowia lipolytica (Yarrowia lipolytica) engineering bacteria M1, MP1.

[0115] Yarrowia lipolytica M1 and MP1 stored in frozen glycerol tubes were respectively streaked and inoculated on YPG solid plates, and cultured at 30°C for 30 hours.

[0116] Insert the M1 and MP1 colonies grown on the YPG solid plate into 250mL Erlenmeyer flasks containing 50ml of YPD liquid medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L), 30°C, 220rpm Shake the culture at rotational speed to activate it.

[0117] Seed culture: Transfer 1ml of activated culture solution to 250mL Erlenmeyer flask containing 50mL seed medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L) and cultivate aerobically at 220rpm for 24h at 30°C .

[0118] Fermentation culture: Take 2mL of activated culture solution and transfer to 50mL fermentation YPD medium (peptone 20g / L, yeast powd...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
pore sizeaaaaaaaaaa
Login to view more

Abstract

The invention discloses a method for positioning and synthesizing terpenoids by means of the Yarrowia lipolytica way. The method comprises the steps that an acetoacetyl coenzyme A thiolase, HMG-CoA synthetase and HMG-CoA reductase in the synthetic route of mevalonic acid in Yarrowia lipolytica are over-expressed and positioned to the peroxisome, and engineering bacteria MP1 are obtained; on the basis of the engineering bacteria MP1, the alpha-farnesene synthesis way is expressed, and engineering bacteria FP1 are obtained; or, the beta-carotene synthesis way is expressed, and engineering bacteria CP1 are obtained; or, the linalool synthesis way is expressed, engineering bacteria LP1 are obtained; the bacteria FP1 or CP1 or LP1 can synthesize the terpenoids under the aerobatic condition by means of a culture medium containing fatty acid or grease, and the yield of the synthesized terpenoids is higher compared with a traditional method. According to the method, fatty acid, grease and cheap food waste oil can be used for generating mevalonic acid downstream terpenoids, and the considerable application prospect and the economic value are achieved.

Description

technical field [0001] The invention relates to a method for locating and synthesizing terpenoids by using the Yarrowia lipolytica pathway, which belongs to the field of microbial technology and fermentation engineering. Background technique [0002] Terpenoids are compounds derived from megludecanoic acid, and the molecular skeleton is based on the isoprene unit and its derivatives. Terpenoids are a relatively important class of compounds in Chinese herbal medicine. Many compounds have been found to be active ingredients in Chinese herbal medicine. At the same time, they are also an important class of natural spices and indispensable raw materials for cosmetics and food industries. Some compounds are still important. Industrial raw materials. The mevalonate pathway is a very important pathway that widely exists in eukaryotic cells, archaea, gram-positive bacteria and higher plant cells. Isopentenyl diphosphate (IPP) can be generated through the mevalonate pathway, and IPP...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12P7/42C12P5/02C12P23/00C12P7/02C12N15/81C12R1/645
CPCC12P7/42C12P5/026C12P23/00C12P7/02C12N15/815
Inventor 祁庆生侯进蒋新崔志勇郑会会
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap