Method for catalyzed synthesis of chiral ortho-halo-alpha-phenyl ethanol by carbonyl reductase

A technology of carbonyl reductase and reductase, which is applied in the direction of microorganism-based methods, oxidoreductase, biochemical equipment and methods, etc., can solve the problems that cannot meet the needs of the synthesis of chiral ortho-halo-α-phenylethanol, which is rare and other issues, to achieve the effects of good industrial application development prospects, environmental friendliness, and wide substrate adaptability

Active Publication Date: 2019-08-16
杭州文德阶生物科技有限公司
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although chiral ortho-halogenated-α-phenylethanol is an important class of chiral building blocks and biocatalysis has been successfully applied in the synthesis of chiral alcohols by the asymmetric reduction of latent chiral ketones, however, the biocatalytic efficiency There are very few cases of high stereoselective synthesis of chiral ortho-halo-α-phenylethanol, and there are only a handful of biocatalytic methods that can be used for the synthesis of chiral ortho-halo-α-phenylethanol, which cannot satisfy the market at all. Diverse chiral ortho-halo-α-phenylethanol synthesis requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for catalyzed synthesis of chiral ortho-halo-alpha-phenyl ethanol by carbonyl reductase
  • Method for catalyzed synthesis of chiral ortho-halo-alpha-phenyl ethanol by carbonyl reductase
  • Method for catalyzed synthesis of chiral ortho-halo-alpha-phenyl ethanol by carbonyl reductase

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0041] The preparation method of the carbonyl reductase BaSDR1 gene is as follows: the nucleotides shown in SEQ ID No: 3 and the nucleotides shown in SEQ ID No: 4 are respectively used as upstream and downstream primers, and the genomic DNA of Bacillus aryabhattai NWPU-1801 is used as a template. Gene amplification was carried out by PCR, and the full-length 885bp carbonyl reductase gene sequence was obtained.

[0042] The coding gene of the above-mentioned carbonyl reductase BaSDR1 is carried by a recombinant expression vector. These recombinant vectors can be constructed by linking the nucleotide sequence encoding carbonyl reductase BaSDR1 of the present invention to various vectors by conventional methods in the art. The vector can be various conventional vectors in the art, such as various plasmids, phage or virus vectors, etc., preferably pET-30a. Preferably, the recombinant expression vector of the present invention can be obtained by the following method: the carbonyl ...

Embodiment 1

[0046] Embodiment 1: Isolation and identification of bacterial strain Bacillus aryabhattaiNWPU-1801:

[0047] (1) Separation:

[0048] Add 1.0g of local soil samples from Xi'an to 9.0mL of 0.85% normal saline, oscillate fully on a vortex shaker to form a uniform soil suspension, and let it stand for 10min; In a 250mL Erlenmeyer flask with enriched medium, place it in a shaker at 30°C and 220rpm for 24h, then transfer 1.0mL of the culture solution to a fresh enriched medium, and continue to cultivate for 24h; carry out three rounds of enrichment in this way , Dilute the enriched culture solution into multiple gradients and spread it on the plate screening medium, culture it in a 30°C incubator for 24 hours, and obtain a single colony;

[0049] The enrichment medium uses 1.0g / L 2'-fluoroacetophenone as the sole carbon source, and other components are as follows, expressed in final concentration: (NH 4 ) 2 SO 4 5.0g / L, MgSO 4 ·7H 2 O 0.5g / L, NaCl 1.0g / L, K 2 HPO 4 2.0g / L,...

Embodiment 2

[0054] Example 2: Acquisition of gene encoding carbonyl reductase BaSDR1, construction of recombinant plasmid and transformation of Escherichia coli:

[0055] Use a DNA extraction kit to extract the whole genome DNA of Bacillus aryabhattaiNWPU-1801 cells, use the extracted total cell DNA as a template, and use the upstream primer GCTGA GGATCC ATGTCAAAGTTAAATAATCC and downstream primer GCATC CTCGAG TTAAGCTAGTTTCTATTCCGC was used as primer for PCR amplification reaction. The total volume of the PCR reaction system is 50 μL, and the amount of each component added is: 5×PrimeSTAR TM10 μL of HS DNA polymerase buffer, 4 μL of 10 mM dNTP mixture, including: 2.5 mM each of dATP, dCTP, dGTP and dTTP, 1 μL of each upstream primer and downstream primer at a concentration of 50 μM, 1 μL of genomic DNA, PrimeSTAR TM HS DNApolymerase 0.5μL, nucleic acid-free water 32.5μL. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min, followed by a temperature cycle o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of carbonyl reductase BaSDR1 or engineering bacteria containing carbonyl reductase BaSDR1 in asymmetric reduction of latent chiral ortho-haloacetophenone to prepare chiral ortho-halo-alpha-phenyl ethanol. The latent chiral ortho-haloacetophenone has the general structural formula represented by the formula (I), wherein X is one of F, Cl and Br; R1 is hydrogenor halogen. The chiral alcohol with high optical purity can be synthesized with greenness, high efficiency and high stereoselectivity.

Description

technical field [0001] The invention belongs to the technical field of biocatalysis, and in particular relates to a method for synthesizing chiral ortho-halogenated-alpha-phenylethanol catalyzed by carbonyl reductase. Background technique [0002] Enantiomers of chiral compounds often have different efficacies or their effects are very different. Therefore, the synthesis of single enantiomers has attracted more and more attention. As an important chiral synthesis building block, chiral ortho-halo-α-phenylethanol is widely used in the synthesis of high value-added chemical products such as chiral drugs, fine chemicals and agricultural chemicals. For example, (S)-1-(2-fluorophenyl)ethanol is the precursor chiral compound synthesized by α7nChR agonist JN403; (S)-1-(2-bromo-4-fluorophenyl)ethanol is the An important chiral intermediate for the synthesis of potential therapeutic drugs γ-secretase inhibitors; and (R)- and (S)-1-(2-chlorophenyl)ethanol are the bronchial asthma dru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/22C12N9/04C12N15/53C12N15/10C12R1/19C12R1/07
CPCC12N9/0006C12N15/10C12P7/22C12Y101/01184C12Q2531/113
Inventor李爱朋张连兵
Owner杭州文德阶生物科技有限公司