Supercharge Your Innovation With Domain-Expert AI Agents!

Reagent for individual detection and treatment of diabetes, medical composition and preparation method of medical composition

A technology of diabetes and medicine, applied in the field of medicine, can solve the problems of low utilization rate of effective substances, unguaranteed curative effect, lack of toxic and side effects of medicines, etc.

Pending Publication Date: 2019-08-20
XUZHOU UNIV OF TECH
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In the existing combination of Chinese and Western medicines for the treatment of diabetes, on the one hand, the western medicine metformin is a commonly used drug, but due to the lack of drug toxicity and side effects detection, there is a risk of medication; on the other hand, the traditional Chinese medicinal materials used are mostly boiled and taken. , the utilization rate of effective substances is low, and the curative effect cannot be guaranteed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent for individual detection and treatment of diabetes, medical composition and preparation method of medical composition
  • Reagent for individual detection and treatment of diabetes, medical composition and preparation method of medical composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 is used for individualized detection diabetes reagent

[0040] Specifically include: 10×TaqMan Master Mix, two pairs of 100μM forward primers, two pairs of 100μM reverse primers, and two pairs of 50μM probes (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.):

[0041] Among them, the forward primer of rs77630697 site of SLC47A1 gene: TTCATAAGCTCCGT GTTCTGTG;

[0042] Reverse primer: AGTGACATTGATAACCGCGATT;

[0043] Probe wild-type sequence 5'-VIC-AGCTTCATAAGCTCCGTGTTCTGTGGCCACCTGGGCAAGCTGGAGCTGGAT-NFQ-3';

[0044] Mutant sequence 5'-FAM-AGCTTCATAAGCTCCGTGTTCTGTGACCACCTGGGCAAGCTGGAGCTGGAT-NFQ-3'.

[0045] SLC47A1 gene rs77474263 forward primer: TGCCTGTGACA CCCTCAT CT;

[0046] Reverse primer: GTCTGGGTAAGCCTGGACA;

[0047] Probe wild-type sequence 5'-VIC–GCAGCGGAGTGCGCTCGTCCTGCTCTTCTGCTGCTTCCCCTGCTGGGCG CT-NFQ-3';

[0048] Mutant sequence 5'-FAM-GCAGCGGAGTGCGCTCGTCCTGCTCCTCTGCTGCTTCCCCTGCTGGGCGCT-NFQ-3'.

[0049] Amplification system: 10.0 μL of ...

Embodiment 2

[0051] Embodiment 2 is used for the detection method of individualized detection diabetes

[0052] Step 1. Extraction and dilution of DNA samples:

[0053] Genomic DNA was extracted after the venous blood was collected in vacuum blood collection tubes anticoagulated with ethylenediaminetetraacetic acid (EDTA) according to conventional methods. The blood genomic DNA extraction kit was self-built by Shanghai Lianji Medical Laboratory Co., Ltd. Dilute the sample with graded water to 10-50 ng / μL.

[0054] Step 2. Sample detection:

[0055] The amplification system in Example 1 was used to amplify. After the PCR was completed, the 7900HT fluorescent quantitative PCR instrument of ABI Company was used to scan the data, and the corresponding software Applied Biosystems AutoCaller was used for the detection results. TM Software for genotype interpretation.

[0056] Step 3. Test results

[0057] figure 1 It is the genotype detection result of rs77630697 site of SLC47A1 gene. The ...

Embodiment 3

[0059] Embodiment 3 is used for the pharmaceutical composition of individualized treatment diabetes

[0060] According to parts by mass, it includes the following components: 1.0-1.5 parts of yam ethanol extract, 0.5-0.8 part of Polygonatum ethanol extract, 0.36-0.6 part of rehmannia root ethanol extract, 0.12-0.36 part of ginseng ethanol extract, and P. 0.5-0.8 parts, 0.5-0.8 parts of trichosanthes ethanol extract, 0.36-0.6 parts of kudzu root ethanol extract, 0.36-0.6 parts of corn silk water extract, and 0.75-1 part of metformin.

[0061] Preferably, the mass ratio of Chinese yam ethanol extract, Polygonatum ethanol extract, Rehmannia glutinosa ethanol extract, Ginseng ethanol extract, Herba Vermiliae ethanol extract, Trichosanthes trichosanthis ethanol extract, Pueraria root ethanol extract, corn silk water extract 1:0.6:0.48:0.24:0.6:0.6:0.48:0.48.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reagent for individual detection and treatment of diabetes, a medical composition and a preparation method of the medical composition. The detection reagent is used for detecting two SNP site subtypes of metformin medication, namely an rs77474263 site of an SLC47A1 gene and an rs77630697 site of the SLC47A1 gene; the detection reagent comprises 10*TaqMan Master Mix, a 100[mu]M forward primer, a 100 [mu]M backward primer and a 100[mu]M probe; and the medical composition comprises traditional Chinese medicines and Western medicines, wherein the Western medicines are metformin hydrochloride tablets, and the traditional Chinese medicines are prepared by mixing a Chinese yam alcohol extract with a rhizoma polygonati methanol extract, a dried rehamnnia root alcohol extract, a ginseng alcohol extract, a discolorous clinquefoil root alcohol extract, a radix trichosanthis alcohol extract, a radix puerariae alcohol extract and a corn stigma water extract. The composition has cooperativity, and the glucose metabolism and the insulin sensibility of patients are notably adjusted.

Description

technical field [0001] The invention belongs to the technical field of medicines, and in particular relates to a reagent for individualized detection and treatment of diabetes, a pharmaceutical composition and a preparation method thereof. Background technique [0002] Diabetes mellitus is a common endocrine and metabolic disease characterized by chronic hyperglycemia. The most common type is type 2 diabetes mellitus (T2DM), which accounts for about 90% of the total number of diabetics. T2DM is a highly heterogeneous metabolic disease, its etiology and pathogenesis are complex, and it has obvious genetic susceptibility. It is currently believed that it is jointly participated by multiple risk factors such as genetics, environment, behavior, lifestyle, and race. and interacting multifactorial diseases. [0003] Diabetes is mainly treated with hypoglycemic drugs. According to statistics, among the 120 million diabetic patients in the country, 40% of them fail to meet the drug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11A61K36/899A61P3/10A61K31/155
CPCC12Q1/6883A61K36/8945A61K36/8969A61K36/804A61K36/258A61K36/73A61K36/428A61K36/488A61K36/899A61K31/155A61P3/10C12Q2600/156A61K2236/333A61K2236/39A61K2236/53A61K2236/51A61K2236/331A61K2300/00
Inventor 董玉玮蒯斐苗敬芝李文王陶李同祥
Owner XUZHOU UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More