Reagent for individual detection and treatment of diabetes, medical composition and preparation method of medical composition
A technology of diabetes and medicine, applied in the field of medicine, can solve the problems of low utilization rate of effective substances, unguaranteed curative effect, lack of toxic and side effects of medicines, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1 is used for individualized detection diabetes reagent
[0040] Specifically include: 10×TaqMan Master Mix, two pairs of 100μM forward primers, two pairs of 100μM reverse primers, and two pairs of 50μM probes (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.):
[0041] Among them, the forward primer of rs77630697 site of SLC47A1 gene: TTCATAAGCTCCGT GTTCTGTG;
[0042] Reverse primer: AGTGACATTGATAACCGCGATT;
[0043] Probe wild-type sequence 5'-VIC-AGCTTCATAAGCTCCGTGTTCTGTGGCCACCTGGGCAAGCTGGAGCTGGAT-NFQ-3';
[0044] Mutant sequence 5'-FAM-AGCTTCATAAGCTCCGTGTTCTGTGACCACCTGGGCAAGCTGGAGCTGGAT-NFQ-3'.
[0045] SLC47A1 gene rs77474263 forward primer: TGCCTGTGACA CCCTCAT CT;
[0046] Reverse primer: GTCTGGGTAAGCCTGGACA;
[0047] Probe wild-type sequence 5'-VIC–GCAGCGGAGTGCGCTCGTCCTGCTCTTCTGCTGCTTCCCCTGCTGGGCG CT-NFQ-3';
[0048] Mutant sequence 5'-FAM-GCAGCGGAGTGCGCTCGTCCTGCTCCTCTGCTGCTTCCCCTGCTGGGCGCT-NFQ-3'.
[0049] Amplification system: 10.0 μL of ...
Embodiment 2
[0051] Embodiment 2 is used for the detection method of individualized detection diabetes
[0052] Step 1. Extraction and dilution of DNA samples:
[0053] Genomic DNA was extracted after the venous blood was collected in vacuum blood collection tubes anticoagulated with ethylenediaminetetraacetic acid (EDTA) according to conventional methods. The blood genomic DNA extraction kit was self-built by Shanghai Lianji Medical Laboratory Co., Ltd. Dilute the sample with graded water to 10-50 ng / μL.
[0054] Step 2. Sample detection:
[0055] The amplification system in Example 1 was used to amplify. After the PCR was completed, the 7900HT fluorescent quantitative PCR instrument of ABI Company was used to scan the data, and the corresponding software Applied Biosystems AutoCaller was used for the detection results. TM Software for genotype interpretation.
[0056] Step 3. Test results
[0057] figure 1 It is the genotype detection result of rs77630697 site of SLC47A1 gene. The ...
Embodiment 3
[0059] Embodiment 3 is used for the pharmaceutical composition of individualized treatment diabetes
[0060] According to parts by mass, it includes the following components: 1.0-1.5 parts of yam ethanol extract, 0.5-0.8 part of Polygonatum ethanol extract, 0.36-0.6 part of rehmannia root ethanol extract, 0.12-0.36 part of ginseng ethanol extract, and P. 0.5-0.8 parts, 0.5-0.8 parts of trichosanthes ethanol extract, 0.36-0.6 parts of kudzu root ethanol extract, 0.36-0.6 parts of corn silk water extract, and 0.75-1 part of metformin.
[0061] Preferably, the mass ratio of Chinese yam ethanol extract, Polygonatum ethanol extract, Rehmannia glutinosa ethanol extract, Ginseng ethanol extract, Herba Vermiliae ethanol extract, Trichosanthes trichosanthis ethanol extract, Pueraria root ethanol extract, corn silk water extract 1:0.6:0.48:0.24:0.6:0.6:0.48:0.48.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

