Construction and application of novel angiotensin converting enzyme inhibitor screening model

A technology for screening angiotensin and inhibitors, applied in biochemical equipment and methods, enzymes, enzymes, etc., can solve the problems of ignoring the specificity of ACE membrane protein and the difference in activity of ACE inhibitory peptides, etc., to achieve stable integration and improve purity , a wide range of effects

Inactive Publication Date: 2019-08-23
JILIN UNIV
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, in the process of studying the structure-activity relationship between food-derived ACE inhibitory peptides and ACE, a variety of structure-activity relationship models have been constructed, mainly including the C domain model of ACE, the N domain model of ACE, etc., but such models Most of the screened ACE inhibitory peptides have large differences in in vivo and in vitro activities
The reason may be that these models are based on the ACE reaction system in the free state in vitro, ignoring the particularity of ACE as a membrane protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of novel angiotensin converting enzyme inhibitor screening model
  • Construction and application of novel angiotensin converting enzyme inhibitor screening model
  • Construction and application of novel angiotensin converting enzyme inhibitor screening model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of the C domain recombinant plasmid of ACE

[0027] Step 1. According to the full gene information of ACE in the NCBI database (sequence number: 1636), use the HG11598-NH plasmid containing complete human ACEORF as a template, and use PrimerPremier5.0 to design primers, and obtain the upstream primer as: 5'AAGCTTATGCCGTTGCCTGACAACTACCC3' (containing HindⅢ restriction site), the downstream primer is 5'GAATTCTCACACCATCACCATCACCATGGAGTGTCTCAGGCTCCACCTC3' (containing EcoRI restriction site and histidine tag sequence). Use TaqDNA polymerase to amplify through a PCR amplification instrument. After the reaction is over, use agarose gel electrophoresis to test the PCR product, and recover the product with the correct test result. The recovered product is the target gene, that is, the human source. Angiotensin converting enzyme C domain protein cDNA.

[0028] Step 2, the gene fragment of the C domain protein of human source ACE and the eukaryotic express...

Embodiment 2

[0030] Example 2: Expression and purification of the C domain protein of ACE

[0031] Step 1, in F12-K (Gibco) medium containing 10% fetal bovine serum, 37 ° C, 5% CO 2 CHO-K1 cells were cultured under these conditions. 2 × 10 per well in a 6-well plate 5 Cells were plated, and after overnight culture, transfected with transfection reagent TurboFect for 1 to 5 hours; the transfection amount of plasmid pcDNA3.1(+)-ACEC was 500 to 900 ng per well, and the amount of transfection reagent TurboFect was 1 to 500 ng. 5 μL.

[0032] Step 2: Cultivate the transfected cells, recover the cells cultured for 48h, 72h, and 96h respectively, and use the cell membrane protein and cytoplasmic protein extraction kit to separate the C domain protein of ACE from the cell membrane to obtain the crude membrane The protein concentration was 23 μg / μL, and Western Blot was used to identify whether the protein structure and the expression of the His-tag tag were correct for the isolated membrane pro...

Embodiment 3

[0034] Example 3: Construction of a screening model for novel angiotensin-converting enzyme inhibitors

[0035] Step 1. Dissolve phospholipid / cholesterol in a mixed solution of chloroform and methanol with a mixing ratio of 1:1 to 4:1 according to the ratio of 6:1 to 9:1, and remove chloroform and methanol by rotary evaporation at 50 to 70°C. Methanol was added to the reconstitution buffer (10-40mM HEPES, 100-150mM NaCl, 2-6% w / w glycerol, pH7.5) to dissolve the liposomes. Extruded from the extruder, finally obtained a simulated film that was stable for 4 hours at room temperature.

[0036] Step 2. On this basis, reconstitute the purified C-domain protein of ACE and the simulated membrane prepared in Step 1 at a ratio of 1:10 to 1:30, and control the reaction temperature to 20-37°C. The time ranges from 10 to 40 minutes. During this process, the mixed system is slightly shaken. After the band reaction, a screening model for a new type of angiotensin-converting enzyme inhibito...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction and application of a novel angiotensin converting enzyme inhibitor screening model, and belongs to the technical field of biotechnology and food development. Specifically, the C structural domain protein of an angiotensin converting enzyme is successfully expressed by PCR, plasmid construction, protein extraction and the like, a stable liposome simulated membrane is obtained by combining repeated freezing and thawing with liquid nitrogen and extrusion with a liposome extruder, and finally the angiotensin converting enzyme bound with the simulated membraneis obtained; the enzyme activity of the system is measured by high-performance liquid chromatography, and it is verified that the model has practical significance. The constructed screening model canbe specifically used for exploring the functional rule of angiotensin converting enzyme inhibitors in membrane surface environments and is expected to provide a new idea for screening the angiotensinconverting enzyme inhibitors; meanwhile, the problem of large difference between in-vivo activity and in-vitro activity in screening of the angiotensin-converting enzyme inhibitors can be better solved.

Description

technical field [0001] The invention belongs to the technical field of biotechnology and food development, and in particular relates to the construction and application of a novel screening model for angiotensin-converting enzyme inhibitors. Background technique [0002] Hypertension is one of the important causes of cardiovascular and cerebrovascular diseases, and angiotensin I-Converting Enzyme (ACE) plays a very critical role in the regulation of blood pressure in the human body. Inhibiting the activity of ACE has become a key factor in the treatment of hypertension. important means. [0003] At present, in the process of studying the structure-activity relationship between food-derived ACE inhibitory peptides and ACE, a variety of structure-activity relationship models have been constructed, mainly including the C domain model of ACE, the N domain model of ACE, etc., but such models Most of the screened ACE inhibitory peptides have large activity differences between in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N5/10G01N33/68
CPCC12N9/485C12Y304/17023C12N15/85C12N5/0682G01N33/68C12N2510/00
Inventor刘静波刘畅张婷刘博群
OwnerJILIN UNIV