Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and method for rapid isothermal amplification detection of vibrio splendidus based on microfluidic chip

A microfluidic chip and isothermal amplification technology, which is applied in the field of microbial detection, can solve the problem that the pollution is affected by human beings, the application and promotion are limited, and the amplification efficiency, detection specificity and repeatability of the Vibrio brilliant LAMP detection system are difficult to meet the application Requirements and other issues, to achieve the effect of early rapid detection and timely prevention, reliable chip structure design, and avoid human interference

Pending Publication Date: 2019-09-24
DALIAN MARITIME UNIVERSITY
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the results of literature research, there are few reports on the detection of Vibrio candidia LAMP, and the previous verification results show that the amplification efficiency, detection specificity and repeatability of the existing Vibrio candido LAMP detection system are difficult to meet the application requirements , and the entire detection process involves a multi-step separation process, there is a risk of contamination and the possibility of human influence, which limits the application and promotion of this method to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for rapid isothermal amplification detection of vibrio splendidus based on microfluidic chip
  • Primer and method for rapid isothermal amplification detection of vibrio splendidus based on microfluidic chip
  • Primer and method for rapid isothermal amplification detection of vibrio splendidus based on microfluidic chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Vibrio resplendent LAMP primer arsB specific detection

[0035] 1. LAMP primer design and screening

[0036] Select the conserved region sequence of the target gene of Vibrio candidiasis to design LAMP primers, screen according to the design principles of LAMP primers, parameter optimization and amplification effect, and finally determine 3 pairs of primers designed for the specific region in the arsenic resistance gene arsB of Vibrio candidiasis. The specific sequence is as follows:

[0037] SEQ ID NO.1: F3: AAGCGCAACGTTCACTAG

[0038] SEQ ID NO.2: B3: GGGTATTGAATACGACAAGAAC

[0039] SEQ ID NO. 3: FIP: CTCAGACCAAGCGTTTGCAGGTAAATCAGCACGGGTACT

[0040] SEQ ID NO.4: BIP:ATACCGAATACAGAGATAGCTACGGCGTCAATCGCATTCACAG

[0041] SEQ ID NO.5: LF:GCGTTATCGGCCCACTGATT

[0042] SEQ ID NO.6: LB:TAGTTCGAAGTTGTTGCCTGTC

[0043] 2. DNA template preparation

[0044] The samples were Vibrio resplendent strains, and the reference strains were 9 different pathogenic bacteria ...

Embodiment 2

[0047] Example 2 Repeatability Detection of Vibrio candidia LAMP Primer arsB

[0048] According to the method of Example 1, the template was lysed by boiling (8min), centrifuged (12000 rpm×5min) and diluted to 5×10 6 CFU / mL Vibrio brilliant liquid, each experiment was repeated to detect the same template 6 times, the experiment was repeated three times, and the statistics of T P The relative standard deviation (CV) of the value, the result is as figure 2 As shown, the CV value of each experiment was less than 10%, and the CV value of the three experiments was 6.73%, which indicated that the LAMP detection system of Vibrio splendidus using arsB primer had good repeatability.

Embodiment 3

[0049] Example 3 Detection of Vibrio splendidus LAMP based on four-reaction cell array (2×2) microfluidic chip

[0050] 1. LAMP primer design and screening

[0051] See Example 1.

[0052] 2. Microfluidic chip preparation

[0053] Microfluidic chip structure see image 3 , the material of the microfluidic chip is silicon wafer / PDMS, including a 2 × 2 array of reaction cells, the distance between the centers of the reaction cells is 9mm, and each group of reaction cell arrays contains a liquid addition hole, a liquid addition channel and several points. Each reaction pool is connected to the liquid injection hole through a connecting channel, and the connecting channels of each reaction pool are symmetrical in position and equal in length. Before using the chip, add 1 μL of sterile water (as a negative control pool), 10×arsB primer (as a sample pool), sterile water and 10×arsB primer to reaction pools 1 to 4, dry at room temperature, and The chip is sealed and stored for fu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a method for rapid isothermal amplification detection of vibrio splendidus based on a microfluidic chip and belongs to the technical field of microbial detection. According to the method, a loop-mediated isothermal amplification (LAMP) system containing three pairs of primers and a reaction pool array microfluidic chip detection method are adopted, three pairs of primers designed for a specific region in a vibrio splendidus arsenic-resistant gene arsB are finally determined through LAMP primer design and screening, and specific sequences are shown as SEQ ID NO.1 / SEQ ID NO.2; SEQ ID NO.3 / SEQ ID NO.4; SEQ ID NO.5 / SEQ ID NO.6. The method is used for isothermal amplification detection of the vibrio splendidus based on the microfluidic chip, has high amplification efficiency and specificity, is simple and rapid in operation process, makes results stable and reliable, can be well used for early rapid detection and timely prevention and control of the vibrio splendidus and has a good application prospect.

Description

technical field [0001] The invention relates to a microfluidic chip-based primer for rapid detection of isothermal amplification of Vibrio splendidus and a method thereof, belonging to the technical field of microbial detection. Background technique [0002] As one of the most common sea cucumber epidemics, "rotting skin syndrome" has the characteristics of strong infectivity and wide spread. A large number of pathogenic bacteria reproduce and produce extracellular products in exposed parts of sea cucumbers that have been mechanically damaged, and digest other normal diseases. tissue, eventually triggering the autolysis mechanism of sea cucumber, causing the death of sea cucumber, the lethal rate is as high as 90%, and it is very harmful to mariculture. Establishing rapid and accurate detection technology to realize early diagnosis of pathogenic bacteria and immediate detection at the grassroots level is of great significance for the monitoring and effective prevention of Ap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6844
Inventor 钟润涛刘士林王梦雨巩宁孙野青
Owner DALIAN MARITIME UNIVERSITY