Application of high temperature-resistant alpha-rhamnosidase gene and its transformation of rutin to isoquercetin

A technology of rhamnosidase and rutin, applied in the fields of genetic engineering technology and biomedicine, can solve problems such as single component, and achieve the effects of excellent thermal stability and strong transformation ability.

Inactive Publication Date: 2019-10-18
INST OF CHEM IND OF FOREST PROD CHINESE ACAD OF FORESTRY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved: In view of the existing problems of enzymatic conversion of rutin to prepare isoquercetin, this patent provides an α-rhamnosidase gene that has strong thermal stability and can efficiently remove the rhamnosyl group of rutin. And through genetic engineering technology to obtain a recombinant α-rhamnosidase MTHRHA with stable catalytic performance and a single component, which can effectively convert rutin to obtain isoquercetin through enzymatic catalysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of high temperature-resistant alpha-rhamnosidase gene and its transformation of rutin to isoquercetin
  • Application of high temperature-resistant alpha-rhamnosidase gene and its transformation of rutin to isoquercetin
  • Application of high temperature-resistant alpha-rhamnosidase gene and its transformation of rutin to isoquercetin

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] The induced expression of the preparation method of α-rhamnosidase in the present invention is specifically to cultivate the recombinant bacteria containing MTHRHA gene in BMMY, and collect the supernatant at the end of the enzyme production stage to obtain the required target enzyme protein.

[0029] The present invention also provides a method for enzymatically converting rutin to prepare isoquercetin, specifically, the α-rhamnosidase of the present invention can enzymatically decompose rutin at pH 5.5 and 70°C to prepare isoquercetin white.

Embodiment 1

[0031] Example 1: Construction of recombinant plasmid pPICZαA-MTHRHA

[0032] The primers were designed according to the codon-optimized M.thermophila ATCC 42464 high temperature resistant α-rhamnosidase gene, and the primers were synthesized by Shanghai Bioengineering Co., Ltd. The primer sequences are as follows:

[0033] P1: CCG GAATTC GCTGTTACTCGAACACACCTACA, the underline indicates the EcoR I site (SEQ ID NO.3).

[0034] P2: TGC TCTAGA TTTCCTTAACTGCATAATGGTGA, the Xba I site is underlined, and the stop codon is removed (SEQ ID NO. 4).

[0035] Using the cDNA of M.thermophila ATCC 42464 as a template, carry out PCR amplification, the amplification condition is 95°C, 5min; pause the timer, add Pyrobest polymerase, add 40μL paraffin oil to seal; 30 cycles (94°C, 30s; 58 ℃, 30s; 72℃, 2min); 72℃, 10min; the reaction was stopped, and kept at 4℃. PCR amplification products were purified by gel recovery kit. The DNA molecule of α-rhamnosidase MTHRHA was obtained.

[0036...

Embodiment 2

[0037] Embodiment 2: the preparation of α-rhamnosidase of the present invention

[0038] After linearizing the ScaI restriction endonuclease, the recombinant plasmid pPICZαA-MTHRHA was transformed into Pichia pastoris GS115 host bacteria (purchased from Novagen), and the YPDS plate (LB medium: peptone 20g / L) containing the antibiotic Zeocin (100 μg / mL) , yeast extract 10g / L, glucose 20g / L, sorbitol 1M, agar 15g / L) after culturing at 28°C, pick the ingots into 200mL BMMY medium at 28°C, shake at 200rpm until OD 600 When the concentration is 0.8, add the inducer every 24 hours to a final concentration of 0.5%. After culturing at 30°C for 15 days, use a high-speed refrigerated centrifuge to centrifuge the culture solution at 13,000 rpm for 15 minutes at 4°C, and collect the supernatant as the target enzyme protein .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to heat-resistant alpha-rhamnosidase, which can efficiently transform rutin to isoquercetin, and the heat-resistant alpha-rhamnosidase of the invention has excellent thermal stability; the alpha-rhamnosidase of the present invention can be almost completely transformed after being incubated with rutin under suitable conditions, and more active isoquercetin can be obtained.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biomedicine, and specifically relates to an α-rhamnosidase and its application in preparing isoquercetin by transforming rutin. Background technique [0002] Rutin is a common flavonoid that is widely found in Chinese herbal medicines, fruits, vegetables, and many plant derivatives. It has various biological activities such as antioxidant, antihyperglycemic and neuroprotective effects. Studies have shown that compared with its derhamnosylated product isoquercetin (quercetin-3-β-D-glucoside) and derutinosylated product quercetin, rutin, although the flavone structure of the mother nucleus They are exactly the same, only the type and quantity of glycosyl groups are different, but the biological activities of the three have significant differences. Compared with rutin and quercetin, isoquercetin has significant advantages in terms of activity: 1. Isoquercetin has better bioavailabi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/56C12N15/81C12P19/60
CPCC12N9/2402C12N2800/22C12P19/60C12Y302/0104
Inventor解静聪
OwnerINST OF CHEM IND OF FOREST PROD CHINESE ACAD OF FORESTRY