Aspergillus niger strain with high rhamnosidase yield

A technology of rhamnosidase and Aspergillus niger, applied in the field of genetic engineering, can solve problems such as difficult to achieve purity

Inactive Publication Date: 2019-11-08
QINGDAO VLAND BIOTECH GRP
View PDF10 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, with the increasing application of α-L-rhamnosidase, the traditional fermentation production method cannot meet the growing demand, and it is difficult to achieve high purity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus niger strain with high rhamnosidase yield
  • Aspergillus niger strain with high rhamnosidase yield
  • Aspergillus niger strain with high rhamnosidase yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Cloning of rhamnosidase gene

[0024] Aspergillus aculeatus ( Aspergillus aculeatus ) genome as a template, using primers 1 and 2 to amplify a rhamnosidase gene fragment, its nucleotide sequence is SEQ ID NO: 2, and its encoded amino acid sequence is SEQ ID NO: 1.

[0025] PCR primers and reaction conditions are as follows:

[0026] Primer 1 (F): ATGTTGTGGTCATCCTGGATC;

[0027] Primer 2 (R): CTATAGCCCTTCAAGGTCCA.

[0028] The reaction conditions were as follows: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 seconds, renaturation at 58°C for 30 seconds, extension at 72°C for 120 seconds, and after 30 cycles, incubation at 72°C for 10 minutes. The results of agarose electrophoresis showed that the size of the amplified rhamnosidase gene was 1845bp.

Embodiment 2

[0029] Example 2 Construction of recombinant vector

[0030] The above-mentioned rhamnosidase gene was amplified by PCR, and XbaI sites were introduced at both ends of the primers. The primer sequences are as follows:

[0031] Primer 3 (F): GTA TCTAGA ATGTTGTGGTCATCCTGGATC;

[0032] Primer 4 (R): GAC TCTAGA CTATAGCCCTTCAAGGTCCA.

[0033] The PCR reaction conditions were as follows: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 s, renaturation at 58°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose gel electrophoresis showed that the rhamnosidase gene was a fragment with a size of 1845bp.

[0034] The rhamnosidase gene fragment obtained above and the expression vector pSU were subjected to single digestion with restriction endonuclease XbaI respectively, and the digestion conditions were as follows:

[0035] PCR fragment digestion system (50ul) Plasmid pSU enzyme digestion ...

Embodiment 3

[0039] Example 3 Recombinant expression of rhamnosidase

[0040] 1. Protoplast preparation:

[0041]Inoculate Aspergillus niger host strain Su12 on PDA+U (potato 200g / L, boil for 20-30min, then filter to remove residue; glucose 2%; Uridine 1%; agar powder 1.5%), culture at 30°C for 5-7d; cut 2cm Bacteria blocks with a size of ×2cm were inoculated into 100ml liquid PDA+U (potato 200g / L, boiled for 20-30min and then filtered to remove residue; glucose 2%; Uridine 1%) medium, cultured at 30°C for 16h to grow mycelia for Transformation: After filtering the grown mycelia, resuspend with 20ml 1.2M magnesium sulfate solution; add 0.2g lysozyme, culture at 30°C, 100rpm for 2-3h; filter the lysed mycelium with 2 layers of lens paper , centrifuge at 3000rpm for 10min to obtain protoplasts; filter the lysed mycelia with lens paper, and centrifuge to obtain protoplasts; then resuspend with an appropriate amount of sorbitol solution.

[0042] 2. Conversion:

[0043] The Aspergillus nige...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an aspergillus niger strain with high rhamnosidase yield and an application thereof. The applicant firstly constructs the aspergillus niger engineering strain for recombinant expression of a rhamnosidase gene, and then further screens to obtain a mutant strain with high rhamnosidase yield through an ultraviolet mutagenesis method, and the preservation number of the mutant strain is CCTCC NO: M2019432. After the mutant strain is fermented in a 20L tank for 160h, the enzyme activity of rhamnosidase in the mutant strain fermentation supernatant reaches 1002 U / ml and is improved by 109.2% in comparison with that of the starting strain, and an unexpected technical effect is achieved. The aspergillus niger strain can be widely applied to production of rhamnosidase, so thatthe production cost of the rhamnosidase is reduced, and popularization and application of the aspergillus niger strain in the field of food processing are promoted.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an Aspergillus niger strain with high rhamnosidase production and application thereof. [0002] technical background [0003] α-L-rhamnosidase (α-L-rhamnosidase (EC3.2.1.40)) belongs to the converting glycoside hydrolase class, which can specifically and efficiently hydrolyze many glycosides such as naringin, rutin, orange peel α-L-rhamnosyl at the terminal of glycosides. α-L-rhamnosidase has a wide range of sources, and α-L-rhamnosidase has been found in animal tissues, plants and microorganisms. At present, there are relatively few reports on α-L-rhamnosidase from animal tissues and plants, mainly through bacteria (such as Bacillus, Bacteroides, Lactobacillus and Monas, etc.) and fungi (such as Aspergillus, Penicillium, Trichoderma, Absidia, Schizobacter, etc.) to obtain α-L-rhamnosidase. [0004] Domestic research on rhamnosidase mainly focuses on the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/15C12N9/24C12R1/685
CPCC12N9/2402C12Y302/0104
Inventor徐晓东李瑞陆娜
OwnerQINGDAO VLAND BIOTECH GRP