A mutant strain of Trichoderma with stable and high phytase production
A mutant strain, phytase technology, applied in the direction of enzymes, hydrolytic enzymes, fungi, etc., can solve the problem of low phytase production, phytase thermal stability, and protease resistance. The enzymatic properties cannot fully meet the needs of feed processing and Phytase application requirements and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1: Cloning of phytase gene and construction of expression vector
[0017] According to Trichoderma ( Trichoderma sp. ), the codon preference of E. coli ( Escherichia coli ) The amino acid sequence SED ID NO: 1 of the phytase Phy gene from ) was codon-optimized, and its coding nucleotide sequence SED ID NO: 2 was synthesized by General Biosystems (Anhui) Co., Ltd.
[0018] Design upstream and downstream primers Phy-F and Phy-R according to the synthesized nucleotide sequence, the sequences are as follows:
[0019] Phy-F: GGC TCTAGA CAGTCGGAGCCCGAGCTGAAGC;
[0020] Phy-R: ATA ACGCGT TTAGAGCGAGCAGGCGGGAATT.
[0021] Using the synthesized nucleotide sequence as a template, the upstream and downstream primers Phy-F and Phy-R were used for amplification, and the PCR amplification product was recovered by using a gel recovery kit. The above PCR amplification product was double digested with restriction enzymes XbaI and MluI, and the expression vectors pC2G an...
Embodiment 2
[0022] Example 2: Construction of Trichoderma reesei engineering bacteria UEphy transformed with phytase gene once
[0023] 1. Protoplast preparation
[0024] Take Trichoderma reesei ( Trichoderma reesei ) UE strain spore suspension was inoculated on a PDA plate and cultured at 30°C for 6 days; after the spore production was abundant, a colony of about 1 cm × 1 cm was cut and placed in 120 mL of YEG+U (0.5% yeast powder, 1% glucose) , 0.1% uridine) liquid medium, 30 ° C, 220 rpm shaking culture for 14-16 h;
[0025] The mycelium was collected by filtration with sterile gauze, and washed once with sterile water; the mycelium was placed in a conical flask containing 20 mL of 10 mg / mL lyase solution (Sigma L1412), 30 °C, 90 rpm for 1-2 h ; Use microscope to observe and detect the progress of protoplast transformation;
[0026] Add pre-chilled 20 mL of 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl 2 ) into the above-mentioned Erlenmeyer flask, shake gently, filter ...
Embodiment 3 2
[0044] Example 3 Construction of Trichoderma reesei engineering strain UEphy-P2 with secondary transformation of phytase gene
[0045] 1. Preparation of uracil-deficient host bacteria
[0046] 1.1 Principle:
[0047] 5-fluoroorotic acid can induce bacterial deletion of whey nucleotidyl transferase or orotidine monophosphate decarboxylase in the uracil nucleotide synthesis pathway, so that 5-fluoroorotic acid cannot form toxic substances5 - Fluorouracil nucleotides, which confer resistance to 5-fluoroorotic acid, whose pyrimidine nucleotide nutrition can be supplemented by adding uracil to the medium, thus taking advantage of 5-fluoroorotic acid-induced formation of urine Pyrimidine auxotrophic strains can grow in medium containing 5-fluoroorotic acid and uracil; while wild-type strains cannot grow in medium containing 5-fluoroorotic acid because they do not have resistance to 5-fluoroorotic acid. grown under the culture conditions. Therefore, 5-fluoroorotic acid is often us...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More