A kind of immunomagnetic bead kit for detecting Brucella antigen
A technology of immunomagnetic beads and Brucella, which is applied in the biological field, can solve the problems of high nutritional requirements, time-consuming, slow growth of Brucella, etc., meet the requirements of fast and sensitive detection, overcome the long cycle time, and shorten the detection time Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0031] In the present invention, the preparation method of the immunomagnetic beads comprises the following steps:
[0032] 1) washing and resuspending the magnetic beads to obtain the washed and resuspended magnetic beads;
[0033] 2) Mix the excess mouse anti-brucella M5 antigen monoclonal IgG antibody with the washed and resuspended magnetic beads obtained in step 1), shake at 37° C. for 15 to 60 min, and obtain the immunomagnetic bead suspension;
[0034] 3) The immunomagnetic bead suspension obtained in step 2) is subjected to magnetic adsorption, the supernatant is removed, washed, and resuspended to obtain the immunomagnetic beads.
[0035] In the present invention, the magnetic beads are washed and resuspended to obtain the washed and resuspended magnetic beads. The present invention preferably uses PBS buffer for washing and resuspension operations. In the present invention, the washing and resuspension operations are preferably performed in EP tubes. In the presen...
Embodiment 1
[0051] With the Omp19 gene fragment (shown in SEQ ID NO: 4) as the target, the design and synthesis of the primer pair for detecting the Brucella antigen, according to the Brucella abortive strain BRS 19kDa outer membrane protein (Omp19 ) Genome sequence (accession number: KP101384.1) design specific primer pair for Omp19 gene, the sequence of said primer pair is as follows:
[0052] Upstream primer: CCCGGTGAACTGGCTAATC (shown in SEQ ID NO: 1);
[0053] Downstream primer: TCGTAAAGGACGAGTTGCTTG (shown in SEQ ID NO: 2);
[0054] Probe: FAM-CCTCCTGGGCCGTCAATGGCAAG-BHQ1 (shown in SEQ ID NO: 3);
[0055] ATGGGAATTTCAAAAGCAAGTCTGCTCAGCCTCGCGGCGGCTGGCATTGTCCTGGCCGGGTGCCAGAGCTCCCGGCTTGGTAATCTCGATAATGTTTCGCCTCCGCCGCCGCCTGCACCGGTCAATGCTGTTCCGGCAGGCACGGTGCAGAAAGGCAATCTTGATTCTCCCACACAATTCCCCAATGCGCCCTCCACGGATATGAGCGCGCAATCCGGCACACAGGTCGCAAGCCTGCCGCCTGCATCCGCACCGGACCTGACGCCCGGCGCCGTGGCTGGCGTCTGGAGCGCCTCGCTTGGTGGTCAGAGCTGCAAGATCGCGACGCCGCAGACCAAATATGGCCAGGGCTATCGCGCAGGCCCGCTGCGCTGCCCCGGTGA...
Embodiment 2
[0058] Preparation of immunomagnetic beads
[0059] (1) Purification of ascites IgG of mouse anti-brucella M5 antigen monoclonal antibody (M5 antigen of Brucella was purchased from Qinghai Biological Pharmaceutical Factory Co., Ltd.):
[0060] The specific operation steps of the AKTA FPLC protein purification system of Pharmacia, Sweden:
[0061] 1) Put the infusion inlets (A, B) of the instrument into the corresponding required buffer solution, turn on the computer, select UNICORN software, and in the system control interface, select "manual pump wash FPLC" to select the inlet A used, and execute the function Flush the pipelines and pumps of the purification system;
[0062] 2) connecting protein G affinity chromatography protein purification column;
[0063] 3) System setting: In the system control interface, select "manual pump Flow" to input the flow rate, and input the pump pressure in "insertalarm & mon alarm pressure";
[0064] 4) Balance the purification column: use...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


