Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of immunomagnetic bead kit for detecting Brucella antigen

A technology of immunomagnetic beads and Brucella, which is applied in the biological field, can solve the problems of high nutritional requirements, time-consuming, slow growth of Brucella, etc., meet the requirements of fast and sensitive detection, overcome the long cycle time, and shorten the detection time Effect

Active Publication Date: 2021-06-01
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because Brucella grows slowly and has high nutritional requirements, it is easy to contaminate miscellaneous bacteria during the cultivation process, and is greatly affected by factors such as the cultivation environment and operator techniques, resulting in low separation rate, high separation difficulty, cumbersome operation, and long time-consuming. There are certain biosafety problems, and it is not suitable for rapid diagnosis and processing of a large number of samples, and most tissue samples need to be ground into a suspension, which to a certain extent dilutes the concentration of bacteria in the sample, and other tissues in the tissue Components can also interfere with test results, causing false negative test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of immunomagnetic bead kit for detecting Brucella antigen
  • A kind of immunomagnetic bead kit for detecting Brucella antigen
  • A kind of immunomagnetic bead kit for detecting Brucella antigen

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0031] In the present invention, the preparation method of the immunomagnetic beads comprises the following steps:

[0032] 1) washing and resuspending the magnetic beads to obtain the washed and resuspended magnetic beads;

[0033] 2) Mix the excess mouse anti-brucella M5 antigen monoclonal IgG antibody with the washed and resuspended magnetic beads obtained in step 1), shake at 37° C. for 15 to 60 min, and obtain the immunomagnetic bead suspension;

[0034] 3) The immunomagnetic bead suspension obtained in step 2) is subjected to magnetic adsorption, the supernatant is removed, washed, and resuspended to obtain the immunomagnetic beads.

[0035] In the present invention, the magnetic beads are washed and resuspended to obtain the washed and resuspended magnetic beads. The present invention preferably uses PBS buffer for washing and resuspension operations. In the present invention, the washing and resuspension operations are preferably performed in EP tubes. In the presen...

Embodiment 1

[0051] With the Omp19 gene fragment (shown in SEQ ID NO: 4) as the target, the design and synthesis of the primer pair for detecting the Brucella antigen, according to the Brucella abortive strain BRS 19kDa outer membrane protein (Omp19 ) Genome sequence (accession number: KP101384.1) design specific primer pair for Omp19 gene, the sequence of said primer pair is as follows:

[0052] Upstream primer: CCCGGTGAACTGGCTAATC (shown in SEQ ID NO: 1);

[0053] Downstream primer: TCGTAAAGGACGAGTTGCTTG (shown in SEQ ID NO: 2);

[0054] Probe: FAM-CCTCCTGGGCCGTCAATGGCAAG-BHQ1 (shown in SEQ ID NO: 3);

[0055] ATGGGAATTTCAAAAGCAAGTCTGCTCAGCCTCGCGGCGGCTGGCATTGTCCTGGCCGGGTGCCAGAGCTCCCGGCTTGGTAATCTCGATAATGTTTCGCCTCCGCCGCCGCCTGCACCGGTCAATGCTGTTCCGGCAGGCACGGTGCAGAAAGGCAATCTTGATTCTCCCACACAATTCCCCAATGCGCCCTCCACGGATATGAGCGCGCAATCCGGCACACAGGTCGCAAGCCTGCCGCCTGCATCCGCACCGGACCTGACGCCCGGCGCCGTGGCTGGCGTCTGGAGCGCCTCGCTTGGTGGTCAGAGCTGCAAGATCGCGACGCCGCAGACCAAATATGGCCAGGGCTATCGCGCAGGCCCGCTGCGCTGCCCCGGTGA...

Embodiment 2

[0058] Preparation of immunomagnetic beads

[0059] (1) Purification of ascites IgG of mouse anti-brucella M5 antigen monoclonal antibody (M5 antigen of Brucella was purchased from Qinghai Biological Pharmaceutical Factory Co., Ltd.):

[0060] The specific operation steps of the AKTA FPLC protein purification system of Pharmacia, Sweden:

[0061] 1) Put the infusion inlets (A, B) of the instrument into the corresponding required buffer solution, turn on the computer, select UNICORN software, and in the system control interface, select "manual pump wash FPLC" to select the inlet A used, and execute the function Flush the pipelines and pumps of the purification system;

[0062] 2) connecting protein G affinity chromatography protein purification column;

[0063] 3) System setting: In the system control interface, select "manual pump Flow" to input the flow rate, and input the pump pressure in "insertalarm & mon alarm pressure";

[0064] 4) Balance the purification column: use...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an immunomagnetic bead kit for detecting Brucella antigen, which belongs to the field of biotechnology. The kit includes: immunomagnetic beads, qPCR reaction mixture, upstream primers, downstream primers and probes for detecting Brucella; Bead Conjugates. The kit of the present invention has high sensitivity, good stability, and is fast and effective. Compared with traditional separation methods, it overcomes the low detection rate of Brucella disease materials and the easy degradation of Brucella pathogens in the direct amplification antigen detection process. Moreover, the limited volume of liquid to be tested used in the extraction of pathogenic DNA results in that the extracted DNA cannot meet the minimum requirements for qPCR detection.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an immunomagnetic bead kit for detecting Brucella antigens. Background technique [0002] Brucella is a Gram-negative facultative intracellular parasitic bacterium, which has a unique mechanism of intracellular survival and immunity, and is a natural focal disease. Brucella is not only widely distributed, but also can be parasitic among multiple animal hosts, and can also be transmitted to human hosts through animals, leading to human infection with brucellosis, which is a serious hazard to humans and animals. Healthy allergic zoonotic diseases. Brucellosis can cause animal infection through multiple channels such as skin and mucous membranes, digestive tract and vertical transmission, among which the most dangerous source of infection is sick pregnant animals. Brucella can be excreted along with the fetus, amniotic fluid and placenta during childbirth or abortion, and breast milk ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6804C12Q1/689C12Q1/04
CPCC12Q1/6804C12Q1/689C12Q2531/113C12Q2563/107C12Q2563/143C12Q2563/149
Inventor 尚佑军孙晶晶曹小安吴锦艳尹双辉周建华杨顺利兰喜李学瑞刘永生
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI