Onchorynchus mykiss lc3b gene and onchorynchus mykiss LC3B protein
A gene and rainbow trout technology, applied in genetic engineering, plant genetic improvement, anti-animal/human immunoglobulin, etc., can solve the problem of inability to specifically identify
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Cloning of the CDS region of rainbow trout autophagy gene lc3b:
[0024] 1. Primer design: The primer sequence is F: ATGCCTTCAGAGAAGACATTC,
[0025] R: GGAAGACAGGGGGATAGGTCTG;
[0026] 2. Extraction of total RNA in rainbow trout tissue: Trizol was used to extract total RNA in rainbow trout liver tissue;
[0027] 3. Reverse RNA to cDNA: For the operation steps, refer to the reverse ABI kit K1622 RevertAidTM FirstStrand cDNA Synthesis Kit;
[0028] 4. RT-PCR amplification reaction;
[0029] 5. Gel recovery of PCR reaction products to obtain purified rainbow trout autophagy gene lc3b.
[0030] The nucleotide sequence of the rainbow trout lc3b gene in this embodiment is shown in the nucleotide sequence of SEQ ID NO: 1 after sequencing.
Embodiment 2
[0032] The RNA extraction method in step 2 of embodiment 1 is as follows:
[0033] (1) Homogenization treatment: Grind the liver tissue in liquid nitrogen, add 1 mL Trizol per 100 mg and shake repeatedly, the sample volume does not exceed 10% of the Trizol volume;
[0034] (2) Place the homogenized sample at room temperature for 10 minutes to completely separate the nucleic acid and protein complexes;
[0035] (3) Centrifuge at 4°C and 10000g for 10 minutes, take the supernatant and add it to a new EP tube;
[0036] (4) Add 200 μL of chloroform to the supernatant, shake vigorously for 30 seconds, and place on ice for 5 minutes;
[0037] (5) Centrifuge at 4°C and 10,000g for 15 minutes, then transfer the supernatant aqueous phase to a new EP tube;
[0038] (6) Add 500 μL of isopropanol to the supernatant aqueous phase liquid, and place on ice for 10 minutes;
[0039] (7) Centrifuge at 4°C and 10,000g for 10 minutes, and a white precipitate will appear at the bottom of the EP...
Embodiment 3
[0044] Inversion system and PCR reverse transcription program in Step 3 of Example 1
[0045] The reverse system is:
[0046]
[0047] The PCR reverse transcription program is:
[0048] 25°C 10min
[0049] 37℃ 120min
[0050] 85℃ 5min
[0051] After inversion, the cDNA was divided into aliquots and stored at -20°C, and repeated freezing and thawing should be avoided as much as possible.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap