Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Onchorynchus mykiss lc3b gene and onchorynchus mykiss LC3B protein

A gene and rainbow trout technology, applied in genetic engineering, plant genetic improvement, anti-animal/human immunoglobulin, etc., can solve the problem of inability to specifically identify

Inactive Publication Date: 2020-01-31
HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, currently commercialized antibodies cannot specifically recognize rainbow trout LC3B protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Onchorynchus mykiss lc3b gene and onchorynchus mykiss LC3B protein
  • Onchorynchus mykiss lc3b gene and onchorynchus mykiss LC3B protein
  • Onchorynchus mykiss lc3b gene and onchorynchus mykiss LC3B protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Cloning of the CDS region of rainbow trout autophagy gene lc3b:

[0024] 1. Primer design: The primer sequence is F: ATGCCTTCAGAGAAGACATTC,

[0025] R: GGAAGACAGGGGGATAGGTCTG;

[0026] 2. Extraction of total RNA in rainbow trout tissue: Trizol was used to extract total RNA in rainbow trout liver tissue;

[0027] 3. Reverse RNA to cDNA: For the operation steps, refer to the reverse ABI kit K1622 RevertAidTM FirstStrand cDNA Synthesis Kit;

[0028] 4. RT-PCR amplification reaction;

[0029] 5. Gel recovery of PCR reaction products to obtain purified rainbow trout autophagy gene lc3b.

[0030] The nucleotide sequence of the rainbow trout lc3b gene in this embodiment is shown in the nucleotide sequence of SEQ ID NO: 1 after sequencing.

Embodiment 2

[0032] The RNA extraction method in step 2 of embodiment 1 is as follows:

[0033] (1) Homogenization treatment: Grind the liver tissue in liquid nitrogen, add 1 mL Trizol per 100 mg and shake repeatedly, the sample volume does not exceed 10% of the Trizol volume;

[0034] (2) Place the homogenized sample at room temperature for 10 minutes to completely separate the nucleic acid and protein complexes;

[0035] (3) Centrifuge at 4°C and 10000g for 10 minutes, take the supernatant and add it to a new EP tube;

[0036] (4) Add 200 μL of chloroform to the supernatant, shake vigorously for 30 seconds, and place on ice for 5 minutes;

[0037] (5) Centrifuge at 4°C and 10,000g for 15 minutes, then transfer the supernatant aqueous phase to a new EP tube;

[0038] (6) Add 500 μL of isopropanol to the supernatant aqueous phase liquid, and place on ice for 10 minutes;

[0039] (7) Centrifuge at 4°C and 10,000g for 10 minutes, and a white precipitate will appear at the bottom of the EP...

Embodiment 3

[0044] Inversion system and PCR reverse transcription program in Step 3 of Example 1

[0045] The reverse system is:

[0046]

[0047] The PCR reverse transcription program is:

[0048] 25°C 10min

[0049] 37℃ 120min

[0050] 85℃ 5min

[0051] After inversion, the cDNA was divided into aliquots and stored at -20°C, and repeated freezing and thawing should be avoided as much as possible.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an onchorynchus mykiss lc3b gene and onchorynchus mykiss LC3B protein, relates to an onchorynchus mykiss gene and onchorynchus mykiss protein, and provides onchorynchus mykisslc3b gene sequence and onchorynchus mykiss LC3B protein, and a preparation method of an onchorynchus mykiss LC3B protein polyclonal antibody. The nucleotide sequence of the onchorynchus mykiss lc3b gene is shown as a nucleotide sequence in SEQID NO:1. The amino acid sequence of the onchorynchus mykiss LC3B protein is shown as SEQID NO:2. The invention provides a material base for research of autophagy of cold-water fishes. The preparation method can meet requirements for obtaining of polyclonal antibodies of the cold-water fishes.

Description

technical field [0001] The invention relates to a rainbow trout gene and a rainbow trout protein. Background technique [0002] Rainbow trout (Onchorynchus mykiss) has delicious meat, no fishy smell, high protein and fat content, and almost zero cholesterol content, making it one of the varieties that are widely farmed in the world. The breeding output and breeding area are increasing year by year. In recent years, the mechanism of gonad and muscle development of rainbow trout has been extensively studied, making it an important model organism among cold-water fish. Autophagy is the self-digestion process of cells. It is a cellular process for the degradation of intracellular proteins and organelles. It is very important for growth and development and disease occurrence. Autophagy-associated microtubule-associated protein 1 light chain 3B (Microtubμle-associated protein 1 light chain 3B, LC3B) is the corresponding form of Atg8 in eukaryotes, and it is a marker protein of au...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/46C12N15/70C07K16/18G01N33/68
CPCC07K14/461C07K16/18C12N15/70G01N33/68G01N2333/4603
Inventor 黄天晴徐革锋谷伟王炳谦
Owner HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com