Kit for detecting serum anti-Annexin A2-IgG antibody
A kit and serum technology, applied in the biological field, can solve the problems of difficult research, few podocytes, and the inability of primary cells to proliferate, and achieve the effects of improving accuracy and specificity, easy operation, and improving the positive detection rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Embodiment 1, prokaryotic expression and purification of Annexin A 2 The antigen was obtained from GenBank (CM-000677.2) encoding human Annexin A 2 The cDNA partial sequence of the gene (chromosome15, 101bp from base60347151-60347252:-TGATTTTATTTTATTTTATTTCATTTAAATTTAACTTAAATAGCGACACTTGGATAGGGGCAACCATACTGTACAGCTCAGTCCCGAGCTTTCTTCCTACA-) was used to design primers. GAATTC TGATTTTATTTTATTTTA-3' (underlined with EcoRI Restriction site), downstream 5′- GGATCC AGTAGGAAGAAAGCT-3' (the underline contains BamHI Restriction site), connected with pMD19-T vector, transformed JM109 competent cells, picked monoclonal colonies, and sent to the company for sequencing after preliminary identification by colony PCR and double enzyme digestion. To connect successfully Annexin A 2 -PMD19-T was digested with EcoRI / BamHI double enzymes, the target fragment was recovered, connected with pET28a after the same double enzyme digestion, and pET28a-Annexin A 2 The plasmid was transformed...
Embodiment 2
[0058] Embodiment 2, anti-Annexin A 2 - Preparation of IgG antibody standard
[0059] 2.1 Anti-Annexin A 2 -Extraction of IgG antibody Through our preliminary experiments, a higher content of anti-Annexin A was screened out 2 -IgG antibody serum, then diluted 1:200, take 100ul and add to Annexin A 2 In the coated reaction wells, there are a total of 6 wells. At the same time, add 100ul of reaction buffer to 2 more wells to eliminate non-specific adsorption. Shake and react at 37°C for 2 hours, wash with washing solution for 3 times, and add 100ul of 6mol to 3 wells. Urea, shaking and reacting at 37°C for 20 minutes, so that the specific IgG dissociates into the urea solution, extracts the urea solution and detects the content of IgG dissolved in it, then continues to wash the 3 wells for 2 times, and further conducts anti-assay with the remaining 5 wells. Annexin A 2 - Detection of IgG antibody to analyze whether it contains undissociated IgG antibody and its proportion, s...
Embodiment 3
[0061] Embodiment 3, for detecting anti-Annexin A 2 - Preparation of IgG solid-phase membrane immunoassay kit
[0062] 3.1. Used to detect anti-Annexin A 2 -IgG solid-phase membrane immunoassay kit composition:
[0063] 1. Coated with Annexin A 2 Antigen nitrocellulose membrane,
[0064] 2. Positive quality control (standard product) human anti-His tag immunoglobulin G (purchased from Tribioscience) 3. Negative quality control (antibody diluent)
[0065] 4. Horseradish peroxidase-labeled goat anti-human immunoglobulin G
[0067] 6. Washing liquid
[0068] 7. TMB developer
[0069] 8. Termination solution.
[0070] 3.2. The preparation of antigen-coated nitrocellulose membrane and the detection steps of serum samples are as follows:
[0071] 3.2.1 Coating and blocking: Spot 5 μl of the antigen solution diluted with 0.01M PBS pH7.4 directly on the nitrocellulose membrane and dry it in a 37°C incubator for 30 minutes, place the NC membrane in ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com