Application of Verticillium Wilt resistance-related gene GhSDH1-1

A technology related to cotton verticillium wilt and resistance, applied in the field of application of the gene GhSDH1-1 related to cotton verticillium wilt resistance, can solve the problems of low selection efficiency, long cycle, and affecting cotton yield

Active Publication Date: 2020-03-27
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Cotton Verticillium wilt (Verticillium Wilt) is a soil-borne fungal vascular disease caused by Verticillium dahliae Kleb. It seriously affects the yield of cotton and has become one of the main obstacles to the sustainable production of cotton. , it is difficult to effectively control the
Breeding and planting disease-resistant varieties is the most economical and effective way to control cotton Verticillium wilt. However, due to the lack of excellent antigens in upland cotton, traditional breeding methods have long cycles, high costs, low selection efficiency, and frequent mutations in pathogenic bacteria, cotton is resistant to Verticillium wilt. The progress of breeding is slow, and most of the varieties bred have poor disease resistance, and some disease-resistant varieties lose their resistance quickly after being put into production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Verticillium Wilt resistance-related gene GhSDH1-1
  • Application of Verticillium Wilt resistance-related gene GhSDH1-1
  • Application of Verticillium Wilt resistance-related gene GhSDH1-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Acquisition of cotton gene GhSDH1-1

[0026] Using the resistant variety Zhongzhimian 2 and the susceptible variety Jimian 11 as plant materials, after inoculating cotton Verticillium wilt pathogen Vd080, through metabolomics analysis, it was found that after Verticillium dahliae infected cotton, the root cells The accumulation of succinic acid decreased significantly, while the accumulation of fumaric acid increased significantly. Further, through the gene analysis and pre-test of succinate dehydrogenase, it was found that the expression level of the gene GhSDH1-1 was significantly increased after the resistant variety was inoculated with Verticillium dahliae, which constitutes succinate dehydrogenase (SDH) Subunit gene, so named GhSDH1-1.

Embodiment 2

[0027] Embodiment 2 investigates the expression of GhSDH1-1 gene in cotton after pathogenic bacteria and hormone treatment

[0028] The cotton variety Zhongzhimian No. 2 was planted in vermiculite sandy soil paper pots, the roots were inoculated with Vd080 spore suspension, and root RNA was extracted at different time periods.

[0029] Spray with 0.01mM salicylic acid (SA) and 0.1mM methyl jasmonate (JA) until the leaves drip, and extract root RNA at different time periods.

[0030] According to the gene sequence and CDS sequence of GhSDH1-1, the fluorescent quantitative primers are designed as follows:

[0031] GhSDH1-1-F:TGTATCACCATGCACTCCGCTG,

[0032] GhSDH1-1-R:ACTGGCCGGTAATCCAGTCTCA.

[0033] Detect the expression of GhSDH1-1 after pathogenic bacteria and hormone treatment.

[0034] Such as figure 1 As shown, in the disease-resistant varieties, the expression of GhSDH1-1 was up-regulated at all time periods after inoculation with pathogenic bacteria, and the differen...

Embodiment 3

[0036] Example 3 Utilizes virus-mediated gene silencing technology (VIGS) to study the function of GhSDH1-1

[0037] 1. Silencing of GhSDH1-1 in Cotton

[0038] Primers for the GhSDH1-1 silencing vector were designed according to the VIGS primer design principles:

[0039] SDH-VIGS-F: CGGAATTCGAGGACGGAACACTACAT,

[0040] SDH-VIGS-R: CGAGCTCCACGAGACCCTTCAGTAA.

[0041] The silent fragment was amplified using the cDNA of Zhimian No. 2 in the disease-resistant variety as a template, and transformed into TRV-156 vector, and transformed into E. coli DH5α competent cells. After sequencing and verification, the TRV-156-GhSDH1-1 plasmid was extracted, and Transform Agrobacterium GV3101 competent, after the colony PCR verification is correct, expand the culture, use pYL-156 empty load as the control, and TRV-156-PDS as the positive control (after the PDS gene is silenced, the leaves show albinism), and auxiliary After the plasmid TRV-192 was mixed and allowed to stand, the No. 2 cot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention pertains to the technical field of agricultural biotechnology, and specifically relates to application of a Verticillium Wilt resistance-related gene GhSDH1-1. The gene GhSDH1-1 has a nucleotide sequence shown as SEQ ID No. 1. Being inoculated with a Verticillium Wilt pathogen Vd080 spore suspension, gene GhSDH1-1 silencing plants become more susceptible; and it is found by mechanismresearches that, in the silencing plants, synthesis of callose decreases, reactive oxygen species (ROS) reduces, and some defense genes subject to down-regulation. In addition, arabidopsis thaliana subjected to GhSDH1-1 gene transgenosis shows relatively strong resistance to Verticillium Wilt. Thus, the gene GhSDH1-1 is positively correlated with Verticillium Wilt resistance of cotton, and can beapplied in disease resistance breeding of the cotton.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to the application of a gene GhSDH1-1 related to cotton verticillium wilt resistance. Background technique [0002] Cotton Verticillium wilt (Verticillium Wilt) is a soil-borne fungal vascular disease caused by Verticillium dahliae Kleb. It seriously affects the yield of cotton and has become one of the main obstacles to the sustainable production of cotton. , is still difficult to be effectively controlled. Breeding and planting disease-resistant varieties is the most economical and effective way to control cotton Verticillium wilt. However, due to the lack of excellent antigens in upland cotton, traditional breeding methods have long cycles, high costs, low selection efficiency, and frequent mutations in pathogenic bacteria, cotton is resistant to Verticillium wilt. The progress of breeding is slow, and most of the varieties bred have poor disease resistance,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N15/82A01H5/00A01H6/60
CPCC12N9/001C12Y103/99001C12N15/8282
Inventor朱荷琴张向月冯鸿杰师勇强魏锋冯自力赵丽红
OwnerINST OF COTTON RES CHINESE ACAD OF AGRI SCI