Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nanobody capable of resisting H9N2 subtype avian influenza viruses, preparation method and application

A bird flu virus and nano-antibody technology, applied in the direction of virus/bacteriophage, anti-viral immunoglobulin, biochemical equipment and methods, etc., can solve the problems of cumbersome operation, prone to errors, false positives, etc., and achieve simple operation and time-consuming Short, high-sensitivity effects

Active Publication Date: 2020-05-19
NORTHWEST A & F UNIV
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method is cumbersome to operate, requires subjective judgment, and is prone to false positives, especially when the antibody titer in the serum is quantified, it is prone to errors; the serological ELISA method for detecting anti-H9N2 AIV antibodies in chicken serum includes indirect and Blocking ELISA, but the existing commercial ELISA kits are developed and produced based on traditional antibodies. This type of ELISA kit requires labeled antibodies and the use of enzyme-labeled secondary antibodies, which leads to increased production costs and hinders its wide-scale application. promotional use of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nanobody capable of resisting H9N2 subtype avian influenza viruses, preparation method and application
  • Nanobody capable of resisting H9N2 subtype avian influenza viruses, preparation method and application
  • Nanobody capable of resisting H9N2 subtype avian influenza viruses, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Construction, expression and purification of prokaryotic expression vector for NP protein of H9N2 subtype avian influenza virus

[0046] 1. Construction of prokaryotic expression vector for NP protein of H9N2 subtype avian influenza virus

[0047] Take 1mL of allantoic fluid containing H9N2 AIV, according to Viral DNA / RNA Kit (TransGen, ER201-01) manual extracts viral RNA, uses RNA as a template, and obtains cDNA by reverse transcription. The reverse transcription system is shown in Table 1.

[0048] Table 1

[0049]

[0050] Reaction conditions: reaction at 25°C for 10 minutes; reverse transcription at 50°C for 30 minutes; reaction at 85°C for 10 seconds to terminate the reaction.

[0051] According to the gene sequence encoding H9N2 NP protein (such as SEQ ID NO: 2), design specific primers: H9N2-NP-F1: ATGGCGTCTCAAGGCACCAA;

[0052] H9N2-NP-R1: TCAATTGTCATATTCCTCTG.

[0053] Using cDNA as a template, using a polymerase GXL DNA Polymerase (R050A, TaKaRa), PC...

Embodiment 2

[0079] Screening and Preparation of Anti-H9N2 Subtype Avian Influenza Virus NP Protein Nanobodies

[0080] 1. Protein emulsification

[0081] After emulsifying 1mL of purified H9N2-NP protein with the same volume of Freund's adjuvant, the Alxa Bactrian camel was subcutaneously immunized in the neck, emulsified with complete Freund's adjuvant for the first time, and incomplete Freund's adjuvant for the last 4 times emulsification.

[0082] 2. Camels are immune

[0083] The emulsified immunogen was subcutaneously passed through the neck to immunize adult male Alxa Bactrian camels. Thereafter, the immunogen emulsified with Freund's incomplete adjuvant was used every two weeks, and the same method was used to boost immunization 5 times, and blood was collected 4 days after the last immunization; indirect ELISA (purified H9N2-NP recombinant protein was used as the coating antigen, 400ng / well) to detect the antibody titer in camel serum after 5 immunizations. As a result, it was...

Embodiment 3

[0137] Expression and preparation method of an anti-H9N2-NP protein nanobody and HRP fusion protein

[0138] 1. Construction of H9N2-NP-Nb5-HRP recombinant eukaryotic expression vector

[0139]The eukaryotic expression vector pEGFP-N1-HRP based on the engineered Nanobody-HRP fusion protein (Sheng, Y., et al., Nanobody-horseradish peroxidase fusion protein as an ultrasensitive probe to detect antibodies against Newcastle disease virus in the immunoassay. JNanobiotechnology, 2019.17(1): p.35), by double digestion with Pst I and Not I, the obtained VHH gene encoding the nanobody was connected to the pCMV-N1-HRP vector, and the positive plasmid was obtained by bacterial liquid PCR and sequencing identification (Such as Figure 11 shown).

[0140] 2. Expression and preparation of H9N2-NP-Nb5-HRP fusion protein

[0141] Combine the successfully constructed H9N2-NP-Nb5-HRP positive plasmid with Medium and Lipo8000 TM After the transfection reagent was mixed, 293T cells were add...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nanobody capable of resisting H9N2 subtype avian influenza viruses, a preparation method and an application. The amino acid sequence of the nanobody is as shown in SEQID NO:1. The nucleocapsid protein of the H9N2 subtype avian influenza viruses is expressed through a prokaryotic expression technique, then the nucleocapsid protein is used as an immunogen for immunizing Bactrian camels, a phage library is constructed, then a nanobody capable of resisting H9N2 nucleocapsid protein is obtained through screening by a phage display technique, then the nanobody and horse radish peroxidase (HRP) are subjected to fusion expression, and a fusion protein of the nanobody and the HRP is successfully prepared. When the fusion protein is applied to detection of antibodies capable of resisting H9N2 subtype avian influenza viruses (AIV) in chicken serum, the inventor finds that a detection method constructed through the fusion protein is high in sensitivity, and has the advantages that the operation is simple, secondary antibodies do not need to be used, and time consumed for detecting samples is short.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nanobody against the nucleocapsid protein of H9N2 subtype avian influenza virus, a preparation method of the nanobody, and detection of the nanobody after fusion expression with horseradish peroxidase Application of anti-H9N2 avian influenza virus antibodies in chicken serum. Background technique [0002] Avian influenza (Avian influenza, AI) is a systemic or respiratory systemic disease in birds caused by influenza virus, which occurs widely all over the world. In my country, with the mandatory immunization of highly pathogenic AI vaccines in recent years, the low pathogenic H9N2 subtype avian influenza virus (AI virus, AIV) has become one of the important diseases that endanger the healthy development of my country's poultry industry. The virus infection can cause egg production decline, broiler chicken growth retardation, and chicken immunosuppression, thus causing serious econ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10C07K16/00C07K19/00C12N15/85G01N33/68G01N33/58G01N33/569
CPCC07K16/1018C07K16/005C12N15/85G01N33/6854G01N33/581G01N33/56983C07K2317/569C07K2317/22C07K2319/61C12N2800/107G01N2333/11G01N2469/20
Inventor 赵钦孙亚妮王坤周恩民
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com