Nanobody capable of resisting H9N2 subtype avian influenza viruses, preparation method and application
A bird flu virus and nano-antibody technology, applied in the direction of virus/bacteriophage, anti-viral immunoglobulin, biochemical equipment and methods, etc., can solve the problems of cumbersome operation, prone to errors, false positives, etc., and achieve simple operation and time-consuming Short, high-sensitivity effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Construction, expression and purification of prokaryotic expression vector for NP protein of H9N2 subtype avian influenza virus
[0046] 1. Construction of prokaryotic expression vector for NP protein of H9N2 subtype avian influenza virus
[0047] Take 1mL of allantoic fluid containing H9N2 AIV, according to Viral DNA / RNA Kit (TransGen, ER201-01) manual extracts viral RNA, uses RNA as a template, and obtains cDNA by reverse transcription. The reverse transcription system is shown in Table 1.
[0048] Table 1
[0049]
[0050] Reaction conditions: reaction at 25°C for 10 minutes; reverse transcription at 50°C for 30 minutes; reaction at 85°C for 10 seconds to terminate the reaction.
[0051] According to the gene sequence encoding H9N2 NP protein (such as SEQ ID NO: 2), design specific primers: H9N2-NP-F1: ATGGCGTCTCAAGGCACCAA;
[0052] H9N2-NP-R1: TCAATTGTCATATTCCTCTG.
[0053] Using cDNA as a template, using a polymerase GXL DNA Polymerase (R050A, TaKaRa), PC...
Embodiment 2
[0079] Screening and Preparation of Anti-H9N2 Subtype Avian Influenza Virus NP Protein Nanobodies
[0080] 1. Protein emulsification
[0081] After emulsifying 1mL of purified H9N2-NP protein with the same volume of Freund's adjuvant, the Alxa Bactrian camel was subcutaneously immunized in the neck, emulsified with complete Freund's adjuvant for the first time, and incomplete Freund's adjuvant for the last 4 times emulsification.
[0082] 2. Camels are immune
[0083] The emulsified immunogen was subcutaneously passed through the neck to immunize adult male Alxa Bactrian camels. Thereafter, the immunogen emulsified with Freund's incomplete adjuvant was used every two weeks, and the same method was used to boost immunization 5 times, and blood was collected 4 days after the last immunization; indirect ELISA (purified H9N2-NP recombinant protein was used as the coating antigen, 400ng / well) to detect the antibody titer in camel serum after 5 immunizations. As a result, it was...
Embodiment 3
[0137] Expression and preparation method of an anti-H9N2-NP protein nanobody and HRP fusion protein
[0138] 1. Construction of H9N2-NP-Nb5-HRP recombinant eukaryotic expression vector
[0139]The eukaryotic expression vector pEGFP-N1-HRP based on the engineered Nanobody-HRP fusion protein (Sheng, Y., et al., Nanobody-horseradish peroxidase fusion protein as an ultrasensitive probe to detect antibodies against Newcastle disease virus in the immunoassay. JNanobiotechnology, 2019.17(1): p.35), by double digestion with Pst I and Not I, the obtained VHH gene encoding the nanobody was connected to the pCMV-N1-HRP vector, and the positive plasmid was obtained by bacterial liquid PCR and sequencing identification (Such as Figure 11 shown).
[0140] 2. Expression and preparation of H9N2-NP-Nb5-HRP fusion protein
[0141] Combine the successfully constructed H9N2-NP-Nb5-HRP positive plasmid with Medium and Lipo8000 TM After the transfection reagent was mixed, 293T cells were add...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap