Unlock instant, AI-driven research and patent intelligence for your innovation.

Antibody for specific detection of braf gene mutation and use thereof in preparation of cancer detection kit

An antibody and species-specific technology, applied in specific peptides, measuring devices, instruments, etc., can solve the problems of not providing antibody structure, unable to obtain monoclonal antibodies, unable to detect mutant proteins at the same time, etc., to achieve good specificity and accuracy Effect

Active Publication Date: 2020-09-11
方达医药技术(上海)有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, immunohistochemistry can specifically detect the V600E mutant protein of the BRAF gene, but cannot simultaneously detect other types of mutant proteins such as V600K
However, the study did not provide a specific structural form of the antibody, and researchers were unable to obtain the corresponding monoclonal antibody

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody for specific detection of braf gene mutation and use thereof in preparation of cancer detection kit
  • Antibody for specific detection of braf gene mutation and use thereof in preparation of cancer detection kit
  • Antibody for specific detection of braf gene mutation and use thereof in preparation of cancer detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Preparation of Immunogen

[0024] According to the requirements for the preparation of V600-specific monoclonal antibodies at the target site, and according to the structural characteristics of the BRAF protein, the optimal immune polypeptide sites were selected through analysis, which are BRAF V600E protein: gdfglateksrw and BRAF V600 protein: gdfglatvksrw; The double repeating unit is used as an immunogen to enhance subsequent immune activity. According to the expression characteristics of Escherichia coli, the corresponding coding sequences were respectively obtained:

[0025] BRAF V600E protein coding sequence:

[0026] 1 GGTGACTTTG GTCTGGCGAC CGAGAAAAGC CGTTGGGGTG ATTTTGGCCT GGCAACCGAGAAATCTCGTT

[0027] 71 GGGGCGACTT CGGCCTGGCT ACCGAAAAAT CCCGTTGGGG CGACTTTGGC CTGGCAACGGAAAAATCCCG

[0028] 141 CTGG

[0029] BRAF V600 protein coding sequence:

[0030] 1 GGTGACTTTG GTCTGGCAAC CGTAAAATCT CGTTGGGGCG ACTTCGGTCT GGCGACGGTTAAATCCCGTT

[0031] 71 GGGGTGATT...

Embodiment 2

[0035] Example 2 Preparation of Monoclonal Antibody

[0036] For the first time, emulsify with Freund's complete adjuvant and an equal volume of antigen (polypeptide protein of Example 1, 100mg / mL) and inject subcutaneously and inguinal mice, 30ug / only; After emulsification with an equal volume of antigen, the mice were alternately immunized intraperitoneally and subcutaneously, 30ug / mouse; after 4 times of immunization, blood was collected from the tail vein, and the anti-antibody titer in the serum of the immunized mice was determined by indirect ELISA method, a total of 12 mice.

[0037] The titer of anti-BRAF V600E protein antibody in immune serum was determined by blood sampling from tail vein. The steps are briefly described as follows: BRAF V600E protein 1ug / ml, 100ul / well coated polystyrene microtiter plate, 4 ℃ coated for 16 h; 0.25% casein blocking solution 300ul / well 4 ℃ blocked 24h. Add the mouse immune serum after doubling dilution to the microtiter plate, 100ul / ...

Embodiment 3

[0043] Example 3 Preparation of Monoclonal Antibody

[0044] (1) Preparation of monoclonal antibody ascites Culture the 600E-7 hybridoma cell line to the logarithmic growth phase, collect the cells by centrifugation, wash the cells twice with pre-cooled PBS, and finally resuspend the cells with an appropriate amount of pre-cooled 1640 medium, Press 3X10 6 -6X10 6 Each cell / mouse was injected intraperitoneally (the mice were injected intraperitoneally with 0.5 ml of Freund's incomplete adjuvant in an umbrella shape 1 week ago), and the ascites was collected about 2 weeks later, and the ascites supernatant was collected after centrifugation, and immediately added to a final concentration of 0.1 % sodium azide and stored at 4°C for later use.

[0045] (2) Purification of monoclonal antibody Ascitic fluid prepared from hybridoma cells was purified by caprylic acid-ammonium sulfate precipitation method. The operation method is briefly described as follows: add 20 ml of sodium ac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antibody for specifically detecting BRAF gene mutation and its use in cancer detection. The present invention uses the 600E polypeptide to prepare the monoclonal antibody, and uses V600 as the reverse screening protein to finally obtain the monoclonal antibody specific for the 600E mutant polypeptide, and after coupling the monoclonal antibody through magnetic beads, it can specifically The specific detection of 600E mutant cells has good specificity and accuracy, and has a good application prospect.

Description

technical field [0001] The invention relates to the field of antibodies, more specifically to an antibody for specifically detecting BRAF gene mutation and its use in preparing a cancer detection kit. Background technique [0002] The RAF gene is one of the most important proto-oncogenes widely present in mammals, and has three subtypes: ARAF, BRAF, and CRAF. Among them, BRAF has the strongest kinase activity, consists of 18 exons, and encodes a protein of about 94kDa; due to the missense mutation of thymine (T) and adenine (A) in a single base of exon 15, resulting in The valine at the 600th codon of the translated protein is replaced by glutamic acid, resulting in a change in the protein sequence, namely the V600E mutation. In addition to the V600E mutation, many unique and rare non-hotspot mutations were detected in exon 15 of the BRAF gene, such as T599I, T599dup, and K601E. V600E mutation of BRAF gene leads to abnormal conduction of KRAS / BRAF / MAPK pathway, causing exc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/32G01N33/577G01N33/574G01N33/543
CPCC07K16/32C07K2317/35C07K2317/92G01N33/54326G01N33/56966G01N33/57488G01N33/577
Inventor 刘欢侯冬雪
Owner 方达医药技术(上海)有限公司