Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing 1,3-propylene glycol through glycerol fermentation via microorganisms

A technology of microorganisms and glycerin, applied in the field of bioengineering, can solve the problems of low conversion rate and high production cost, and achieve the effect of increasing conversion rate and reducing production cost

Active Publication Date: 2020-07-10
镇江百泰生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems of low conversion rate and high production cost of producing 1,3-propanediol by fermentation of glycerol by a single strain, the present invention provides a method for microbial production of 1,3-propanediol by fermentation of glycerol, that is, the establishment of biosynthesis through co-cultivation of microorganisms The upstream and downstream of the pathway, respectively realize the utilization of glycerol and the production of 1,3-propanediol, reduce the biosynthetic pathway and metabolic pressure, and improve production efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing 1,3-propylene glycol through glycerol fermentation via microorganisms
  • Method for producing 1,3-propylene glycol through glycerol fermentation via microorganisms
  • Method for producing 1,3-propylene glycol through glycerol fermentation via microorganisms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Construction and expression of recombinant Escherichia coli Rosseta-dhaB1dhaB2

[0034] 1) According to the gene sequence of the related glycerol dehydratase (GDHt) and glycerol dehydratase activator (GDHt active factor) of Clostridium butyricum VPI 1718 (GenBank number: AY112989) and the characteristics of the multiple cloning site of the expression vector pANY1, using biological information Synthetic primers designed by the scientific software NTI are: upstream primer F: 5'- GGGGGATCCACTAGTAGGCCT ATGATAAGTAAAGGATTTAG-3' and downstream primer R:5'- CAGGAGCTCCCATGGAGGCCT TTAATGATGATGATGATGGTGCTCAGCTCCAATTGTGCAAG-3', the underlined part is the StuI restriction site, and the wavy part is the upstream and downstream homology arms homologous to the pANY1 plasmid;

[0035] 2) Use Clostridium butyricum YJH-09 genomic DNA as a template to amplify the target gene by PCR. PCR amplification reaction parameters: pre-denaturation: 95°C for 5min, denaturation: 94°C for 2min, a...

Embodiment 2

[0052] Determination of glycerol dehydratase activity:

[0053] 1) Take an appropriate amount of the Rosseta-dhaB1dhaB2 bacterium liquid that has been successfully expressed in Example 1, centrifuge at 4°C for 10 min, collect the bacteria sludge, wash twice with 0.1mol / L potassium phosphate buffer solution of pH 7.4, and wash with an appropriate amount of potassium phosphate after centrifugation The bacteria were resuspended in the buffer, ultrasonically disrupted in an ice bath, centrifuged at 10,000 rpm, 4°C for 10 min, and the supernatant was the crude enzyme solution.

[0054] 2) Determination method of glycerol dehydratase activity: under optimum temperature and optimum pH conditions, according to the above reaction, the amount of enzyme needed to catalyze the generation of 1 μmoL propionaldehyde per minute is defined as one enzyme activity unit. Measured by MBTH (3-methyl-2-benzothiazolinone hydrazine) method, GDHt can catalyze the substrate glycerin (or 1,2-propanediol)...

Embodiment 3

[0057] Determination of 1,3-propanediol dehydrogenase activity:

[0058] 1) Take an appropriate amount of the Rosseta-dhaT bacterial liquid successfully expressed in Example 1, centrifuge at 4°C for 10 min, collect the bacterial sludge, wash twice with 0.1mol / L potassium phosphate buffer solution of pH 7.4, and wash with an appropriate amount of potassium phosphate after centrifugation The bacteria were resuspended in the buffer, ultrasonically disrupted in an ice bath, centrifuged at 10,000 rpm, 4°C for 10 min, and the supernatant was the crude enzyme solution.

[0059] 2) Determination of 1,3-propanediol dehydrogenase reductive activity: under the optimal temperature and optimal pH conditions, according to the above reaction, the amount of enzyme required to generate 1 μmoL 1,3-PD per minute is defined as an enzyme activity unit . In a total volume of 1.0mL, mix the following components according to the final concentration: 27mmol / L propionaldehyde, 0.37mmol / L NADH, 35mmol / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing 1,3-butanediol through glycerol fermentation via a microbial co-culture system. The method comprises the following steps: successfully constructing recombinant escherichia coli Rosseta-dhaB1dhaB2 and Rosseta-dhaT, co-culturing the recombinant escherichia coli, and carrying out seed culture and fermentation culture, wherein the recombinant escherichia coli Rosseta-dhaB1dhaB2 is used for realizing the production of the intermediate metabolite 3-hydroxypropionaldehyde (3-HPA) from glycerol, the recombinant escherichia coli Rosseta-dhaT catalyzes 3-HPAto produce 1,3-propanediol, and in the process of fermentation, a fermentation medium is inoculated with the recombinant escherichia coli in a ratio of 1: 1.5, and a substrate glycerinum with a concentration of 60 g / L of and an auxiliary substrate glucose with a concentration of 10 g / L of are added. According to the method disclosed by the invention, the conversion rate of glycerol and the yieldof 1,3-propylene glycol are increased; and the adopted clostridium butyricum contains glycerol dehydratase which does not depend on coenzyme B12, so the production cost is reduced.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for microorganisms to ferment and produce 1,3-propanediol using glycerol. Background technique [0002] Crude glycerin is one of the main by-products in the production of biodiesel. Every 10kg of biodiesel produced will produce 1kg of crude glycerin. According to reports, it is expected to reach more than 5.87 billion pounds in 2020. If crude glycerin cannot be used and processed in a timely and effective manner, It may become a new source of pollution. Therefore, using glycerol to produce high value-added products and improving the conversion rate of glycerol is a hot spot in current research. [0003] 1,3-Propanediol (1,3-PD), as a good solvent, antifreeze and protective agent, is widely used in the fields of food, medicine, cosmetics and chemical industry. In the field of food, 1,3-propanediol is easy to dissolve food additives that are difficult ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P7/18C12N1/21C12R1/19
CPCC12P7/18C12N9/88C12N9/0006C12Y402/0103C12Y101/01202
Inventor 齐向辉员君华张国艳袁娇张宇飞王洋
Owner 镇江百泰生物科技有限公司