Platanus mutant, method for obtaining platanus mutant and application of platanus mutant or method

A technology of mutants and syringa, applied in the field of transgenics, can solve the problems of poor orientation and long breeding time of sycamore, and achieve the effect of high orientation, simple method and high efficiency

Active Publication Date: 2020-07-17
SHENZHEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the present invention is to provide a sycamore mutant, a method for obtaining a sycamore mutant, and an application thereof, aiming to solve the problems of long-term mutation breeding and poor orientation of sycamore in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Platanus mutant, method for obtaining platanus mutant and application of platanus mutant or method
  • Platanus mutant, method for obtaining platanus mutant and application of platanus mutant or method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Cloning and sequencing of the pollen allergen gene Plaa1 from Platanus annuus

[0096] (1) Select the leaves of Platanus x acerifolia as samples, and use a genome extraction kit to extract Platanus genomic DNA. The sequence of the fifth primer is shown in SEQ ID No.3, which is: 5'-tacgcggggaacaaaacaatccaat-3'; the sixth primer The sequence shown in SEQ ID No.4 is: 5'-ccgaagagggccaaatatcataca-3', and the Platanus pollen allergen plaa1 gene is obtained by PCR amplification reaction.

[0097] The PCR amplification reaction system is as follows: DNA of Platanus leaves: 5uL, fifth primer: 5uL, sixth primer: 5uL, 2×Taq mix: 25uL, Mg2+: 1uL glycerol: 1uL, ddH2O: 12uL.

[0098] The PCR amplification reaction conditions are as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 40 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0099] (2) Obtain the PCR product of the Platanus pollen al...

Embodiment 2

[0101] Construction of genome editing vectors

[0102] (1) Design two sgRNA sequences according to the Platanus sp. gene sequence (SEQ ID No.5), which are the first gRNA target sequence (target T1): CAGCGCCGATATTGTTCAGG and the second gRNA target sequence (target T2): TTCTGCGCGAAGTCTCTTGG.

[0103] Synthesize the sense and antisense strands of the two sgRNA sequences with adapters respectively, the underlined part is the adapter sequence, and form the following two double-stranded DNAs after mixing and annealing:

[0104] Design the first primer SEQ ID No.6 of the first gRNA target sequence: (5'- ATTG CAGCGCCGATATTGTTCAGG-3') and the second primer SEQ ID No.7 (3'-GTCGCGGCTATAACAAGTCCCAAA-5') were mixed and annealed to form the first gRNA target sequence;

[0105] Design the third primer SEQ ID No.8 of the second gRNA target sequence: (5'- ATTG TTCTGCGCGAAGTCTCTTGG-3') and the fourth primer SEQ ID No.9 (3'-AAGACGCGCTTCAGAGAACCCAAA-5') were mixed and annealed to form the se...

Embodiment 3

[0110] genetic transformation

[0111] (1) Obtain the seeds of the mature cones of robust adult Platanus chinensis; the seeds are cleaned to remove the fluff on the surface of the seeds, and then sterilized with 75% alcohol for 40 seconds, 0.1% mercuric chloride for 40 minutes, and rinsed with sterile water for 3 times to obtain Sterilized seeds: placing the sterilized seeds on wet filter paper, and carrying out dark culture at 25° C. for 2 to 3 days to obtain germinated seeds;

[0112] (2) Obtain the germ of the seed. The carrier to be transformed is a 0.6 μm gold powder particle with a diameter of 0.6 μm coated with a genome editing carrier plasmid. The transformation parameters are set to 0.6 μm gold powder and 900 PSI pressure, and the distance between the transformation carrier and the sample is 6 cm. Using BIO - Transforming the genome editing vector into the embryo with the PDS-1000 / He gene gun of RAD to obtain a transformation product.

[0113] (3) Cultivating the tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a platanus mutant, a method for obtaining the platanus mutant and an application of the platanus mutant or the method. A gRNA target sequence of a platanus target gene is designed, a genome editing vector is constructed, transformation is performed in seed embryos by using a gene gun method to obtain a transformation product, and the transformation product is cultivated andidentified to obtain the platanus mutant. The method can carry out targeted mutation on specific genes of the platanus, and has strong orientation and high efficiency.

Description

technical field [0001] The invention relates to the field of transgenic technology, in particular to a sycamore mutant, a method for obtaining the sycamore mutant, and an application thereof. Background technique [0002] Platanus spp. is a deciduous tree species of Platanus spp. There is only one genus in this family, about 10-12 species, all of which are produced abroad. my country has introduced and cultivated three species: one-ball sycamore (P. occidentalis Linn.), two-ball sycamore (English sycamore, P.acerifolia Willd) and three-ball sycamore (French sycamore, P.orientalis Linn.). Among them, the English sycamore is a hybrid of American sycamore and French sycamore (P. occidental is × P. orientalis), which has good heterosis and has been introduced to my country for more than 100 years. Because of its rapid growth, thick crown, straight trunk, smooth dry skin, pruning resistance, and easy reproduction, it can adapt to urban environments and various soil conditions. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C12N15/29A01H5/00A01H6/00
CPCC12N15/8218C07K14/415
Inventor 夏立新于为常骆超周秋艳
Owner SHENZHEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products