Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a kind of galectin-9 derived from mandarin fish in the preparation of antibacterial agent

A technology of galectin and mandarin fish, applied in medical preparations containing active ingredients, antibacterial drugs, and resistance to vector-borne diseases, etc.

Active Publication Date: 2021-08-10
INST OF AQUATIC LIFE ACAD SINICA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there has been no report on the function of mandarin fish galectin to directly inhibit bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a kind of galectin-9 derived from mandarin fish in the preparation of antibacterial agent
  • Application of a kind of galectin-9 derived from mandarin fish in the preparation of antibacterial agent
  • Application of a kind of galectin-9 derived from mandarin fish in the preparation of antibacterial agent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Preparation and purification of mandarin fish galectin-9 recombinant protein (rScGal9):

[0029] The head kidney tissue of mandarin fish was separated, and the head kidney RNA sample of mandarin fish was obtained by the traditional Trizol (Ambion) extraction method, and the cDNA was obtained by reverse transcription using a commonly used reverse transcription kit (Thermo Scientific). Using the head kidney cDNA as a template, The forward primer is: ScGal9-F1 GACAATGGCTTTTAATCAGCAG; the reverse primer is ScGal9-R1 CTGGATCTCTACACCATCACAGTG, and the full-length ORF sequence of mandarin fish galectin-9 was obtained by PCR reaction using the high-fidelity DNA polymerase produced by Novizyme ( shown in SEQ ID NO.2). After Shanghai Sangon Biotech’s sequencing is correct, design primers containing restriction enzyme sites, clone a BamHI restriction site at the 5’ end, and clone a HindIII restriction site at the 3’ end, the specific forward primer is ScGal9F2>CGCGGATCCATGGCTTTTA...

Embodiment 2

[0033] Detection of Agglutination Bacterial Activity of Galectin-9 Recombinant Protein

[0034] Bacteria: Aeromonas hydrophila AH-1, Streptococcus agalactiae XQ-1, Escherichia coli TOP10, Staphylococcus aureus CICC10384.

[0035] The specific experimental steps are as follows:

[0036] 1. Activate the above four kinds of bacteria on the agar solid plate medium by means of "Z" streaking, place the plate in a 28°C incubator for 24 hours, and then pick the bacterial monoclonal colony on the plate and place it in the liquid In the culture medium, culture in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).

[0037] 2. At room temperature, centrifuge at a speed of 5000r / min for 10 minutes to collect bacteria, add the same volume of sterile PBS buffer to resuspend, centrifuge again to collect bacteria, remove the supernatant, add the same volume of sterile PBS buffer to resuspend hanging.

[0038] 3. Take out the galectin-9 (rScGal9) recombina...

Embodiment 3

[0045] Detection of antibacterial activity of mandarin fish galectin-9 recombinant protein (rScGal9):

[0046] Bacteria: Streptococcus agalactiae XQ-1, Edwardsiella lentus PPD130 / 91 and Flavobacterium columnar G4

[0047] Specific steps are as follows:

[0048] 1. Take out the preserved strains of the above four bacteria from the refrigerator at -80°C, activate the above four bacteria on the agarose solid plate medium by "Z"-shaped streaking, and place the plate in a 28°C incubator After culturing for 24 hours, the bacterial monoclonal colonies on the plate were picked and placed in respective liquid medium, and cultured in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).

[0049] 2. Take out the mandarin fish galectin-9 recombinant protein (rScGal9) solution from the -80°C refrigerator 30 minutes in advance and put it on ice, because the mandarin fish galectin-9 recombinant protein (rScGal9) has Ca 2+ Dependence, so prepare 1M CaCl2 s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology, and specifically discloses the application of a galectin-9 derived from mandarin fish in the preparation of antibacterial agents. The amino acid sequence of the galectin-9 is as shown in SEQ ID NO.1 As shown, the applicant found that mandarin fish galectin-9 (ScGal9) itself has important antibacterial activity, and found that galectin-9 has an antibacterial effect on Streptococcus agalactiae ( S. agalactiae ), Edwardsiella tarda ( E. tarda ) and Flavobacterium columnar ( F. columnare ) has a good inhibitory effect, so fish galectin‑9 (rScGal9) is effective in the treatment of bacterial diseases caused by Streptococcus agalactiae, bacterial septicemia caused by Edwardsiella tarda and Flavobacterium columnar in aquatic animals. It has a good application prospect in the treatment of gill rot.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of galectin-9 derived from mandarin fish in the preparation of antibacterial agents. Background technique [0002] Aquaculture is an important source of food for humans. With the development of intensive and large-scale farming, the frequent occurrence of aquatic diseases has become an important threat to the development of aquaculture. The frequent occurrence of Streptococcus agalactiae disease in tilapia has become a bottleneck restricting the sustainable development of tilapia aquaculture industry; bacterial gill rot caused by Flavobacterium columnar is a global aquaculture disease with great harm , causing huge economic losses to the cultivation of important economic fish such as grass carp and mandarin fish. Edwardsiella tarda causes hemorrhagic sepsis in economically important fish such as flounder, turbot and gibel carp. In the traditional breedin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K38/17A61K48/00A61P31/04
CPCA61K38/1732A61K48/005A61P31/04Y02A50/30
Inventor 梁志刚聂品
Owner INST OF AQUATIC LIFE ACAD SINICA