Supercharge Your Innovation With Domain-Expert AI Agents!

Application of galectin-8 derived from Siniperca chuatsi in preparation of bacteriostatic agent

The technology of galectin and bacteriostatic agent is applied in the application field of galectin-8 in the preparation of bacteriostatic agent, and achieves the effects of good thermal stability and good practical prospect.

Active Publication Date: 2020-04-24
INST OF AQUATIC LIFE ACAD SINICA
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there has been no report on the function of mandarin fish galectin to directly inhibit bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of galectin-8 derived from Siniperca chuatsi in preparation of bacteriostatic agent
  • Application of galectin-8 derived from Siniperca chuatsi in preparation of bacteriostatic agent
  • Application of galectin-8 derived from Siniperca chuatsi in preparation of bacteriostatic agent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Preparation and purification of mandarin fish galectin-8 recombinant protein (rScGal8):

[0030] The RNA sample was obtained from the head kidney tissue of mandarin fish by the traditional Trizol (Ambion) extraction method, and the cDNA was reversed using a commonly used reverse transcription kit (Thermo Scientific). Using the cDNA sample obtained above as a template, forward The primer is: Sc-galectin8-F>CTGCTCCAAAATGTCGATTTCAAAC, the reverse primer is Sc-galectin8-R1>ATGTTAAAGGATCTTGACGTCCAG. The full-length ORF sequence of mandarin fish galectin-8 (shown in SEQ ID NO.2) was obtained by PCR reaction using the high-fidelity DNA polymerase produced by Novizyme. After Shanghai Sangon Biotech's sequencing was correct, primers containing restriction enzyme sites were designed, and the restriction enzyme sites were cloned at both ends of the ORF of ScGal8. Among them, a BamHI restriction site was cloned at the 5' end, and a HindIII restriction site was cloned at the 3' end...

Embodiment 2

[0034] Detection of Gaglectin-8 Recombinant Protein Agglutination Bacterial Activity

[0035] Bacteria: Aeromonas hydrophila AH-1, Streptococcus agalactiae XQ-1, Escherichia coli TOP10, Staphylococcus aureus CICC10384.

[0036] The specific experimental steps are as follows:

[0037] 1. Activate the above four kinds of bacteria on the agar solid plate medium by means of "Z" streaking, place the plate in a 28°C incubator for 24 hours, and then pick the bacterial monoclonal colony on the plate and place it in the liquid In the culture medium, culture in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).

[0038] 2. Under normal temperature conditions, centrifuge at 5000r / min for 10 minutes to collect bacteria, add the same volume of sterile PBS buffer to resuspend, centrifuge again to collect bacteria, remove the supernatant, add the same volume of sterile PBS buffer again solution resuspended.

[0039] 3. Take out the galectin-8 (rScGal8...

Embodiment 3

[0046] Detection of antibacterial activity of mandarin fish galectin-8 recombinant protein (rScGal8):

[0047] Bacteria: Aeromonas salmonicida ATCC27013, Streptococcus agalactiae XQ-1, Edwardsiella tarda PPD130 / 91 and Flavobacterium columnar G4

[0048] Specific steps are as follows:

[0049] 1. Take out the preserved strains of the above bacteria from the refrigerator at -80°C, activate the above four kinds of bacteria on the agarose solid plate medium by "Z" streaking, and place the plate in a 28°C incubator for cultivation After more than 24 hours, the monoclonal colonies on the plate were picked and placed in their respective liquid medium, and cultured in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).

[0050] 2. Take out the mandarin fish galectin-8 recombinant protein (rScGal8) solution from the -80°C refrigerator 30 minutes in advance and put it on ice, because the mandarin fish galectin-8 recombinant protein (rScGal8) has Ca ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biology and specifically discloses the application of galectin-8 derived from Siniperca chuatsi in preparation of a bacteriostatic agent. The amino acidsequence of the galectin-8 is shown as SEQ ID NO. 1. It is found that the Siniperca chuatsi galectin-8 (ScGal8) has important antibacterial activity on typical aquatic animal pathogens; and an antibacterial experiment shows that the galectin-8 has no antibacterial activity on Aeromonas salmonicida (A. Salmonicida) and Edwardsiella tarda (E. Tarda), but has a relatively obvious inhibition effect on Streptococcus agalactiae (S. agalactiae) and Flavobacterium cloumnare (F. cloumnare), so the fish galectin-8 (rScGal8) has good application prospects in the treatment of gill rot diseases of aquaticanimals caused by Flavobacterium cloumnare.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of galectin-8 derived from mandarin fish in the preparation of antibacterial agents. Background technique [0002] Aquaculture is an important source of food for humans. With the development of intensive and large-scale farming, the frequent occurrence of aquatic diseases has become one of the bottlenecks that plague the development of aquaculture. Aeromonas salmonicida is an opportunistic pathogen that mainly infects cold-water farmed fish, causing furunculosis or canker disease in commercial fish such as salmon, trout, and turtle. Streptococcus agalactiae causes streptococcosis in tilapia, which restricts the healthy development of the tilapia industry chain. Edwardsiella tarda can cause hemorrhagic sepsis in economically important fish species including flounder, turbot and flounder. Bacterial gill rot caused by Flavobacterium columnar is a worldwide ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/17A61K48/00A61P31/04
CPCA61K38/1732A61K48/005A61P31/04Y02A40/81
Inventor 聂品梁志刚
Owner INST OF AQUATIC LIFE ACAD SINICA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More