Application of galectin-8 derived from Siniperca chuatsi in preparation of bacteriostatic agent
The technology of galectin and bacteriostatic agent is applied in the application field of galectin-8 in the preparation of bacteriostatic agent, and achieves the effects of good thermal stability and good practical prospect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Preparation and purification of mandarin fish galectin-8 recombinant protein (rScGal8):
[0030] The RNA sample was obtained from the head kidney tissue of mandarin fish by the traditional Trizol (Ambion) extraction method, and the cDNA was reversed using a commonly used reverse transcription kit (Thermo Scientific). Using the cDNA sample obtained above as a template, forward The primer is: Sc-galectin8-F>CTGCTCCAAAATGTCGATTTCAAAC, the reverse primer is Sc-galectin8-R1>ATGTTAAAGGATCTTGACGTCCAG. The full-length ORF sequence of mandarin fish galectin-8 (shown in SEQ ID NO.2) was obtained by PCR reaction using the high-fidelity DNA polymerase produced by Novizyme. After Shanghai Sangon Biotech's sequencing was correct, primers containing restriction enzyme sites were designed, and the restriction enzyme sites were cloned at both ends of the ORF of ScGal8. Among them, a BamHI restriction site was cloned at the 5' end, and a HindIII restriction site was cloned at the 3' end...
Embodiment 2
[0034] Detection of Gaglectin-8 Recombinant Protein Agglutination Bacterial Activity
[0035] Bacteria: Aeromonas hydrophila AH-1, Streptococcus agalactiae XQ-1, Escherichia coli TOP10, Staphylococcus aureus CICC10384.
[0036] The specific experimental steps are as follows:
[0037] 1. Activate the above four kinds of bacteria on the agar solid plate medium by means of "Z" streaking, place the plate in a 28°C incubator for 24 hours, and then pick the bacterial monoclonal colony on the plate and place it in the liquid In the culture medium, culture in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).
[0038] 2. Under normal temperature conditions, centrifuge at 5000r / min for 10 minutes to collect bacteria, add the same volume of sterile PBS buffer to resuspend, centrifuge again to collect bacteria, remove the supernatant, add the same volume of sterile PBS buffer again solution resuspended.
[0039] 3. Take out the galectin-8 (rScGal8...
Embodiment 3
[0046] Detection of antibacterial activity of mandarin fish galectin-8 recombinant protein (rScGal8):
[0047] Bacteria: Aeromonas salmonicida ATCC27013, Streptococcus agalactiae XQ-1, Edwardsiella tarda PPD130 / 91 and Flavobacterium columnar G4
[0048] Specific steps are as follows:
[0049] 1. Take out the preserved strains of the above bacteria from the refrigerator at -80°C, activate the above four kinds of bacteria on the agarose solid plate medium by "Z" streaking, and place the plate in a 28°C incubator for cultivation After more than 24 hours, the monoclonal colonies on the plate were picked and placed in their respective liquid medium, and cultured in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).
[0050] 2. Take out the mandarin fish galectin-8 recombinant protein (rScGal8) solution from the -80°C refrigerator 30 minutes in advance and put it on ice, because the mandarin fish galectin-8 recombinant protein (rScGal8) has Ca ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



