Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RAA primer, probe and detection method for detecting pasteurella multocida diseases

A technology of Pasteurella and multocida, which is applied in the field of bacterial molecular biology detection, can solve the problems of large human subjective factors, complex instruments, and long time-consuming in microscopic examination methods, so as to achieve convenient, fast and accurate identification and reduce detection time , The rapid effect of the detection method

Pending Publication Date: 2020-09-04
CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In clinical practice, the rapid diagnosis of Pasteurella multocida usually adopts smear staining and microscopic examination, but due to the large human-subjective factors of the microscopic examination method, and the sensitivity and specificity are low, misjudgment and missed detection often occur.
In order to improve the sensitivity and accuracy of detection, methods such as bacterial isolation and identification, loop-mediated isothermal amplification (LAMP), and enzyme-linked immunosorbent assay (ELISA) have been used in the laboratory detection of Pm, but these methods are sensitive Disadvantages such as weak sensitivity, poor specificity and time-consuming detection
The application of fluorescent quantitative polymerase chain reaction (PCR) technology in the detection of Pm has greatly improved the sensitivity and specificity of detection, but this method requires repeated heating and cooling, complex instruments and a high detection environment, and is time-consuming. It takes a long time and has certain technical requirements for operators, so it is not suitable for rapid detection on the clinical site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RAA primer, probe and detection method for detecting pasteurella multocida diseases
  • RAA primer, probe and detection method for detecting pasteurella multocida diseases
  • RAA primer, probe and detection method for detecting pasteurella multocida diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Select the conserved region sequence of the Pasteurella multocida kmt1 gene to design primers and probes. Find the corresponding full gene sequence in Genebank (www.ncbi.nlm.nih.gov), and use DNASTAR software for homology analysis and Blast Sequence analysis screened out the highly conserved sequence of the Pasteurella multocida kmt1 gene as follows (this fragment is highly conserved in the Pasteurella multocida kmt1 gene, and is compatible with Mycoplasma, Streptococcus, Escherichia coli, Eperythrozoon, Neospore worm, Toxoplasma gondii, healthy bovine blood and other pathogenic gene sequences have no cross-matching reaction and no cross-reaction):

[0038] TATTTTGGCGTGATGAATCAAGCGGTCACAGAAAAGACAGCAATTTCGAGCAAACAATGGTGGGGCTTTACGCTGATTAATATTGTGCTGACATTACTGCTCTATCCGCTATTTACCCAGTGGGGCGGTGCGAATGAACCGATTGCCGCGAAATTGAGTTTTATGCCACTTGAAATGGGAAATGGCATTATTTTATGNO.GCTCGTTGTTGTGAGTGGGCTTG(ID

[0039] The highly conserved sequence obtained by screening was used as the target gene fr...

Embodiment 2

[0066] Example 2 The method for detecting Pasteurella multocida by RAA fluorescence method

[0067] The method for detecting Pasteurella multocida by RAA fluorescence method comprises the steps:

[0068] (1) Extract the nucleic acid from the bacterial sample according to the bacterial whole genome method, and store it at -20°C for later use;

[0069] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time is 20 minutes;

[0070] (3) Add 13.7 μL of water to 25 μL of reaction buffer, 2.1 μL of upstream and downstream primers and 0.6 μL of probe at a concentration of 10 μM, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction master mix;

[0071] (4) Add 2.5 μL of Mg to the cap of the reaction tube 2+ , fully mixing 4 μL of the nucleic acid extraction solution obtained in the step (1) with the reaction premix solution o...

Embodiment 3

[0137] Embodiment 3 actual sample detection

[0138] (1) The sequences of primers, probes and negative quality controls are the same as in Example 1.

[0139] (2) A total of 15 clinical samples from 1 to 15 in the experiment were provided by Yanbian Prefecture Animal Disease Prevention and Control Center;

[0140] (3) Sample extraction method:

[0141] Extract the nucleic acid from the bacterial liquid sample according to the bacterial genome method, and store it at -20°C for later use;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, probe and detection method for detecting pasteurella multocida by an RAA fluorescence method. The primer and the probe are suitable for detection by the RAA fluorescence method, can accurately detect pasteurella multocida plasmids and positive samples, and do not have cross reactions with mycoplasma, streptococcus, escherichia coli, eperythrozoon, neospora caninum, toxoplasma gondii and healthy cow blood, and the specificity reaches 100%. The detection method is quick, and high flux is easy to realize, besides, the detection time is reduced, and the detectioncost is reduced. A method for quickly detecting pasteurella multocida DNA based on the RAA fluorescence method, provided by the invention, is high in sensitivity, and the reaction detection sensitivity reaches 10copies / [mu] L.

Description

technical field [0001] The invention belongs to the technical field of bacterial molecular biology detection, and in particular relates to a primer, a probe and a detection method for detecting Pasteurella multocida by RAA fluorescence method. Background technique [0002] Pasteurella multocida (Pm) was first isolated from chickens suffering from fowl cholera in 1881. It belongs to the Pasteurella family and can infect a variety of livestock, poultry, wild animals and humans. , is a zoonotic disease. Acute, hemorrhagic or septic symptoms often appear after the body is infected with Pm, such as fowl cholera, bovine hemorrhagic septicemia, swine pneumonia and other diseases. Pm is a Gram-negative bacterium with blunt ends, club-shaped or short rod-shaped, facultative anaerobic bacteria, stained with Giemsa or melanin, showing two-pole dense staining, and has a capsule. The antigenic characteristics of Pm can be grouped according to the capsular sera, and can be divided into ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/01
CPCC12Q1/689C12Q1/6844
Inventor 杜秋明吴晓东郑秀红樊晓旭赵永刚许龙春乔启波赵达卓
Owner CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com