Shewanella for expressing functionalized amyloid fibre, construction method and application thereof
A technology of Shewanella and amyloid, applied in the field of genetic engineering, can solve the problems of no research reports and no research reports, and achieve the effects of rapid reproduction, good adsorption rate, and good commercial application value
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2020-09-22
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Shewanella expressing functionalized amyloid fibers and its construction method and application. Background technique
[0002] Heavy metal pollution is one of the important problems of water pollution, and its main source is industrial wastewater. Heavy metals in aquatic ecosystems are not degraded, their presence in nature can cause them to accumulate in the food chain, which can be toxic to animals and plants, excessive heavy metals can accumulate in plants, and can enter humans and animals through the food chain The body and accumulated, causing acute or chronic poisoning, a serious threat to human life. Therefore, the removal of toxic heavy metals from wastewater needs to be solved urgently.
[0003] Biosorption is the ability of biological materials to accumulate heavy metals from wastewater through metabolic processes or physicochemical adsorptio...
Examples
Embodiment 1
[0028] Example 1: csgA-LACQCL gene synthesis and the construction of recombinant Shewanella expressing functional amyloid fiber curli (csgA-LACQCL)
[0029] Translates the additional peptide domain LACQCL into the nuclear The nucleotide sequence was codon optimized, and the flexible sequence GSGGSG was connected to the C-terminal of the csgA gene to finally construct the gene fragment csgA-LACQCL, whose amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2 shown.
[0030] Use the Primer Premier 5.0 software to design a primer pair for amplifying the csgA-LACQCL sequence. The forward primer sequence is shown in SEQ ID NO.3, namely: CGCCATATGAAACTTTTAAAAGTAGCAGCAAT, and the reverse primer sequence is two segments, respectively, as in SEQ ID NO.4 As shown, namely: GTGGTGCGCCTGAGCTGTATGCACCTGAACCACCTGAACCGTACTGATGAGCGGTCGCG and as shown in SEQ ID NO.5, namely: CCGCTCGAGTTAACCTGAACCACCTGAACCGAATGGTGGCATTGGTGGTGCGCCTGAGCTG.
[0031]Using ...
Embodiment 2
[0032] Example 2: High expression of functionalized amyloid fiber curli (csgA-LACQCL)
[0033] In this example, the expression of amyloid protein was identified by Congo red (CR) staining, and the concentration of amyloid protein fibers was determined by analyzing the amount of CR binding.
[0034] Centrifuge 1 mL of the wild Shewanella culture and the recombinant Shewanella culture obtained in Example 1 at different incubation times (12h, 24h, 36h, 48h) (5000 rpm, 10 minutes), centrifuge Suspend the precipitate with 0.025 mmol / L CR (dissolved in pH 7.4 phosphate buffer) at 30°C for 10 minutes, then centrifuge (5000 rpm, 10 min), collect the supernatant, and detect the CR binding amount in the supernatant . The absorbance of CR was measured by a UV-Vis spectrophotometer at a wavelength of 490 nm. Compared with the absorbance of 0.025 mmol / L CR at 490 nm wavelength, the CR binding amount of wild Shewanella and recombinant Shewanella was calculated.
[0035] figure 2 It is ...
Embodiment 3
[0036] Embodiment 3: Preparation of recombinant Shewanella adsorption membrane
[0037] In this example, a recombinant Shewanella adsorption membrane of functionalized amyloid fiber curli (csgA-LACQCL) was prepared, and the adsorption membrane included recombinant Shewanella and activated carbon. Concrete preparation method comprises the following steps:
[0038] (1) Inoculate the recombinant Shewanella prepared in Example 1 into YESCA medium at a ratio of 1%, and culture it on a shaker at 30°C at 200rpm to OD 600 =2;
[0039] (2) After cultivation, add 700~800mg of activated carbon powder per 1L of bacterial liquid, soak for 10~12h, and then filter through a water-based microporous membrane with a pore size of 0.45mm to obtain a recombinant expressing functionalized amyloid fiber curli (csgA-LACQCL) Shewanella Absorbent Membrane.
[0040] image 3 is the SEM picture of the prepared recombinant Shewanella adsorption membrane; in the figure, the right picture is a partial e...