Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Shewanella for expressing functionalized amyloid fibre, construction method and application thereof

A technology of Shewanella and amyloid, applied in the field of genetic engineering, can solve the problems of no research reports and no research reports, and achieve the effects of rapid reproduction, good adsorption rate, and good commercial application value

Active Publication Date: 2020-09-22
JIANGSU UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whether a biofilm material can be constructed based on amyloid fiber Curli and applied to the adsorption of metal pollution has not yet been reported.
There are no related research reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Shewanella for expressing functionalized amyloid fibre, construction method and application thereof
  • Shewanella for expressing functionalized amyloid fibre, construction method and application thereof
  • Shewanella for expressing functionalized amyloid fibre, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: csgA-LACQCL gene synthesis and the construction of recombinant Shewanella expressing functional amyloid fiber curli (csgA-LACQCL)

[0029] Translates the additional peptide domain LACQCL into the nuclear The nucleotide sequence was codon optimized, and the flexible sequence GSGGSG was connected to the C-terminal of the csgA gene to finally construct the gene fragment csgA-LACQCL, whose amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2 shown.

[0030] Use the Primer Premier 5.0 software to design a primer pair for amplifying the csgA-LACQCL sequence. The forward primer sequence is shown in SEQ ID NO.3, namely: CGCCATATGAAACTTTTAAAAGTAGCAGCAAT, and the reverse primer sequence is two segments, respectively, as in SEQ ID NO.4 As shown, namely: GTGGTGCGCCTGAGCTGTATGCACCTGAACCACCTGAACCGTACTGATGAGCGGTCGCG and as shown in SEQ ID NO.5, namely: CCGCTCGAGTTAACCTGAACCACCTGAACCGAATGGTGGCATTGGTGGTGCGCCTGAGCTG.

[0031]Using ...

Embodiment 2

[0032] Example 2: High expression of functionalized amyloid fiber curli (csgA-LACQCL)

[0033] In this example, the expression of amyloid protein was identified by Congo red (CR) staining, and the concentration of amyloid protein fibers was determined by analyzing the amount of CR binding.

[0034] Centrifuge 1 mL of the wild Shewanella culture and the recombinant Shewanella culture obtained in Example 1 at different incubation times (12h, 24h, 36h, 48h) (5000 rpm, 10 minutes), centrifuge Suspend the precipitate with 0.025 mmol / L CR (dissolved in pH 7.4 phosphate buffer) at 30°C for 10 minutes, then centrifuge (5000 rpm, 10 min), collect the supernatant, and detect the CR binding amount in the supernatant . The absorbance of CR was measured by a UV-Vis spectrophotometer at a wavelength of 490 nm. Compared with the absorbance of 0.025 mmol / L CR at 490 nm wavelength, the CR binding amount of wild Shewanella and recombinant Shewanella was calculated.

[0035] figure 2 It is ...

Embodiment 3

[0036] Embodiment 3: Preparation of recombinant Shewanella adsorption membrane

[0037] In this example, a recombinant Shewanella adsorption membrane of functionalized amyloid fiber curli (csgA-LACQCL) was prepared, and the adsorption membrane included recombinant Shewanella and activated carbon. Concrete preparation method comprises the following steps:

[0038] (1) Inoculate the recombinant Shewanella prepared in Example 1 into YESCA medium at a ratio of 1%, and culture it on a shaker at 30°C at 200rpm to OD 600 =2;

[0039] (2) After cultivation, add 700~800mg of activated carbon powder per 1L of bacterial liquid, soak for 10~12h, and then filter through a water-based microporous membrane with a pore size of 0.45mm to obtain a recombinant expressing functionalized amyloid fiber curli (csgA-LACQCL) Shewanella Absorbent Membrane.

[0040] image 3 is the SEM picture of the prepared recombinant Shewanella adsorption membrane; in the figure, the right picture is a partial e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
pore sizeaaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to Shewanella for expressing functionalized amyloid fibre, a construction method and application thereof. According to the invention, dissimilatory metal reducing bacteria shewanella MR-1 is used as a host of functionalized curli; the peptide structural domain LACQCL is translated into a nucleotide sequence;the nucleotide sequence is connected with the C end of a subunit csgA gene of amyloid fibre curli of escherichia coli through a flexible sequence; and finally, a gene segment csgA-LACQCL expressing functionalized amyloid fibre curli is constructed, so that the function of the peptide structural domain is realized. The invention further provides a heavy metal ion adsorption biological membrane, which has strong tolerance and adsorption effect on various heavy metal ions; furthermore, the heavy metal ion adsorption biological membrane still has excellent metal ion removal rate after repeated adsorption for many times; the defects of long synthesis time, specific adsorption, high cost and the like in the traditional process are overcome; and, the heavy metal ion adsorption biological membrane has good commercial application value in the aspect of metal ion adsorption treatment in a water environment.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Shewanella expressing functionalized amyloid fibers and its construction method and application. Background technique [0002] Heavy metal pollution is one of the important problems of water pollution, and its main source is industrial wastewater. Heavy metals in aquatic ecosystems are not degraded, their presence in nature can cause them to accumulate in the food chain, which can be toxic to animals and plants, excessive heavy metals can accumulate in plants, and can enter humans and animals through the food chain The body and accumulated, causing acute or chronic poisoning, a serious threat to human life. Therefore, the removal of toxic heavy metals from wastewater needs to be solved urgently. [0003] Biosorption is the ability of biological materials to accumulate heavy metals from wastewater through metabolic processes or physicochemical adsorptio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/74C12N11/14C02F3/34C12R1/01C02F101/20
CPCC07K14/245C12N15/74C12N11/14C02F3/34C07K2319/00C02F2101/20Y02E60/50
Inventor 雍阳春索迪方真
Owner JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com