Check patentability & draft patents in minutes with Patsnap Eureka AI!

Ginseng PgbHLH149 transcription factor and application thereof

A technology of pgbhlh149 and transcription factors, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems that restrict the health and sustainable development of the ginseng industry, economic losses, and affect the economic benefits of ginseng planting, etc.

Active Publication Date: 2020-11-10
INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In Fusong and other areas of Jilin Province, the incidence rate of some plots is sometimes as high as 80%, which has caused huge economic losses to ginseng farmers, seriously affected the economic benefits of ginseng planting, and restricted the healthy and sustainable development of my country's ginseng industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ginseng PgbHLH149 transcription factor and application thereof
  • Ginseng PgbHLH149 transcription factor and application thereof
  • Ginseng PgbHLH149 transcription factor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Screening of ginseng iron toxicity-related transcription factor gene PgbHLH149

[0052] The ginseng seedlings were treated with 0.05mM Fe (normal iron concentration), 0.4mM Fe (iron toxicity stress), 0.4mM Fe+Si (0.5mM, 1.5mM, 2.0mM) respectively, and the effective screening for relieving the iron toxicity stress of ginseng was screened. Exogenous substances and their appropriate concentrations, it was found that adding an appropriate amount of silicon (0.5mM) under iron toxicity stress can effectively alleviate the symptoms of iron toxicity in ginseng (see figure 1 and figure 2 ).

[0053] Tissues such as ginseng roots, stems and leaves under different iron treatment conditions were taken, and part of the experimental samples were quick-frozen in liquid nitrogen and stored at -80°C for RNA extraction. Another part of the samples were dried in an oven at 105°C for 30 minutes, and dried at 80°C to constant weight for elemental composition analysis.

[0054]...

Embodiment 2

[0063] Example 2 Cloning and sequencing of ginseng iron toxicity-related transcription factor gene—PgbHLH149 gene

[0064] Since the PgbHLH149 gene sequence information provided by the transcriptome analysis results may not be 100% accurate, the inventors of the present application re-amplified and sequenced the PgbHLH149 gene: using ginseng cDNA as a template, the PgbHLH149 gene sequence was divided into multiple small fragments for amplification. In addition, the sequences of multiple small fragments are designed to overlap and overlap at the beginning and end, and the multiple small fragments are sequenced separately. After the sequencing results are spliced, the complete sequence of the PgbHLH149 gene is obtained.

[0065] The extracted ginseng total RNA was synthesized into cDNA using M-MuLV First Strand cDNA Synthesis Kit M-MuLV First Strand cDNA Synthesis Kit, and used as a template for PCR amplification. Design multiple pairs of primers for amplifying the full-length c...

Embodiment 3

[0085] Example 3 PgbHLH149 gene transfer into Arabidopsis test

[0086] Vector construction experiment:

[0087] 1. Primer design:

[0088] bHLH149-F:AGAACACGGGGGACGAGCTCATGGTATCATTATTTATCTCGAATCCCGA

[0089] bHLH149-R:CCATGGTGTCGACTCTAGAGGATCCTAAAGTCGATGATTGGGATAAATTTGAGC

[0090] 2. Target gene amplification PCR reaction system:

[0091] reaction system Usage amount 2×fast pfu master mix 10.0μl Primer bHLH149-F 1μl Primer bHLH149-R 1μl cDNA 1μl wxya 2 o

up to 20μl

[0092] Reaction program: 94°C: 3min; 94°C: 30sec; 58°C: 45sec; 72°C: 1kb / 30s; 33cycles; 72°C: 10min; 16°C: forever.

[0093] A small fragment (PgbHLH149 gene fragment) was recovered.

[0094] 3. The target gene is connected to the target vector:

[0095] PgbHLH149 gene overexpression vector construction scheme, the map of the PgbHLH149 gene overexpression vector see Figure 5 .

[0096] (1) Digest plasmid pCAMBIA2300-GFP with SacI and BamHI to recover...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a ginseng PgbHLH149 transcription factor and application thereof, and relates to the field of plant transcription factors. According to the ginseng PgbHLH149 transcription factor, through an effective exogenous substance screening test for relieving iron toxicity stress of ginseng, it is found that the symptom of the iron toxicity of the ginseng can be effectively relieved by adding a proper amount of silicon elements under iron toxicity stress, in combination with transcriptome and element analysis results, the new transcription factor-PgbHLH149 transcription factor inthe bHLH transcription factor family is explored, the expression quantity of a PgbHLH149 gene and the iron accumulation quantity in a ginseng body have a remarkable negative correlation trend, namelythe higher the expression quantity of the PgbHLH149 gene is, the lower the iron accumulation quantity in the ginseng body is; and a PgbHLH149 transgenic arabidopsis thaliana experiment shows that theoverexpression of the PgbHLH149 gene in an arabidopsis thaliana can improve the resistance of a transgenic plant to iron toxicity stress.

Description

technical field [0001] The invention relates to the field of plant transcription factors, in particular to a PgbHLH149 transcription factor and its application. Background technique [0002] Ginseng is a perennial herb of the Araliaceae genus Panax. It is a precious Chinese herbal medicine with high medicinal value and is known as the "King of Herbs". Jilin Province is the main production area of ​​ginseng in my country, and its output accounts for 80% of the country and 60-70% of the world. The ginseng cultivation industry plays a pivotal role in the agricultural economy of Jilin Province. Erythroderma is a common physiological disease of ginseng roots, which mainly causes reddish-brown plaques on the periderm of ginseng roots, and the lesion will gradually expand with the increase of ginseng age, resulting in a decline in the commercial grade of ginseng. In areas such as Fusong, Jilin Province, the incidence rate in some plots is sometimes as high as 80%, causing huge eco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00A01H6/20
CPCC07K14/415C12N15/8271
Inventor 王秋霞马莹莹金桥马琳张淋淋邵财孙海李美佳张舒娜刘政波
Owner INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More