Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ELISA kit for detecting salmonella antibody, detection method and application thereof

A Salmonella detection method technology, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of insufficient food safety, high requirements for operators, expensive kits, etc. problem, to achieve the effect of easy observation, good repeatability and high accuracy

Active Publication Date: 2020-12-29
SOUTH CHINA AGRI UNIV
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional detection methods such as plate culture method are widely used, and the detection results are relatively stable, but the operation procedures are cumbersome and time-consuming, and the requirements for operators are high. Traditional detection methods are not enough to ensure food safety issues; immunological detection methods require antibodies , enzymes, etc., are expensive and have problems such as poor specificity; PCR, LCR, LAMP and other modern molecular biology detection methods have been applied to the detection of Salmonella, but these detection methods require the participation of enzymes, PCR instruments, etc.
Therefore, based on the current situation of many deficiencies in the existing detection methods of Salmonella, the relatively expensive price of the existing kits is not conducive to large-scale promotion. The detection method of bacteria is particularly important for maintaining food safety in our country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA kit for detecting salmonella antibody, detection method and application thereof
  • ELISA kit for detecting salmonella antibody, detection method and application thereof
  • ELISA kit for detecting salmonella antibody, detection method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Embodiment 1, the establishment of detecting Salmonella ELISA method

[0049] 1. Preparation of Salmonella invA recombinant protein

[0050] 1. Construction of recombinant vector expressing Salmonella invA recombinant protein

[0051] According to the gene sequence of Salmonella ATCC43973 in GenBank (GenBank: MK017931.1), use Primer5.0 software to design specific primers:

[0052] F: ATTGTCACCGTGGTCCAGTTTATCG (SEQ ID NO. 3)

[0053] R: CTTCATCGCACCGTCAAAGGAA (SEQ ID NO. 4)

[0054] The size is 216bp, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0055] Take the frozen bacterial liquid, extract bacterial DNA according to the bacterial DNA kit, and store it at -20°C for invA gene amplification. PCR amplification was carried out with bacterial DNA as template and F and R as primers.

[0056] The PCR amplification system is shown in Table 1:

[0057] Table 1 PCR amplification system

[0058]

[0059] The reaction conditions were: pre-denaturation at 94...

Embodiment 2

[0106] Embodiment 2, the evaluation of detection Salmonella antibody ELISA method

[0107] 1. Specificity test

[0108] Escherichia coli positive serum, Staphylococcus aureus positive serum, Clostridium welchii positive serum, Haemophilus paragallinarum positive serum, Pasteurella positive serum, Anapest Rimmer were detected according to the ELISA method of detecting Salmonella antibody in Example 1 Salmonella positive serum; the Salmonella positive serum and Salmonella negative serum were used as controls to judge the specificity of the ELISA method.

[0109] The results are shown in Table 4, P / N of Escherichia coli positive serum, Staphylococcus aureus positive serum, Clostridium welchii positive serum, Haemophilus paragallinarum positive serum, Pasteurella positive serum, Riemerella anatipestifer positive serum The values ​​are all less than 2, indicating that the established ELISA method has no cross-reaction with other bacterial sera and has good specificity.

[0110] T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to an ELISA kit for detecting salmonella antibody, a detection method and application thereof, belonging to the technical field of microbial immunology. The ELISA kit comprises antigen protein or antigen protein solution or a coated plate coated with the antigen protein solution, an enzyme-labeled antibody, color developing solution, stop solution, positive serum and negativeserum. The kit can quickly, specifically and sensitively detect the salmonella antibody in the serum, and the sensitivity of detecting the serum antibody is 1: 1000; and the kit has simple and convenient operation, low cost, easy observation of reaction result, high sensitivity and strong specificity, and is applicable to the technical fields of salmonella monitoring, epidemiological investigation, clinical sample detection and the like.

Description

technical field [0001] The invention relates to an ELISA kit for detecting Salmonella antibody, a detection method and application thereof, and belongs to the technical field of microbial immunology. Background technique [0002] Salmonella, Gram-negative bacteria, is a non-spore-encapsulated, short bacillus belonging to the Enterobacteriaceae family. Salmonella is a major pathogenic bacterium that endangers human and animal health, and its genus is complex and diverse. So far, 67 bacterial groups, more than 2,000 serotypes and variants have been isolated from humans and animals. Salmonella enteritidis, Salmonella choleraesuis and Salmonella typhimurium are the most common types of Salmonella. Salmonella can not only cause the death of livestock and poultry, but also exist in poultry products for a long time as a source of infection, seriously threatening human health and food safety. Humans are infected with Salmonella mainly through eating unhygienic meat, eggs, unpasteu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/535C07K14/255C12N15/31C12N15/11C12N15/70
CPCG01N33/56916G01N33/535C07K14/255C12N15/70G01N2333/255G01N2469/20
Inventor 郭莉莉廖晓萍赵永达
Owner SOUTH CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More