Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid liquid-phase hybridization capture and detection method based on magnetic separation and enzyme catalysis

A liquid phase hybridization and detection method technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of poor sample detection flexibility, limited sensitivity, prolonged reaction time, etc. Reduce technical difficulty and condition requirements, improve sensitivity, and achieve specific effects

Pending Publication Date: 2021-01-22
段江波
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the limited contact area between the microwell plate and the sample to be tested, the probability of intermolecular collisions is reduced, resulting in limited sensitivity
To make the reaction more complete, the reaction time needs to be prolonged, which affects the efficiency of detection
(2) Since microporous plates are usually a row of multi-well plates arranged in series, the operating cost of testing only one sample at a time is greatly increased. This type of testing usually needs to collect enough samples before performing unified testing. Poor timeliness from sample to implementation of testing
(3) Due to the need for the whole plate operation of the enzyme plate, once the operation is started, the sample arrangement is locked, and the random insertion test of the emergency position of the sample cannot be performed, and the flexibility of sample detection is poor
The detection sensitivity of this scheme is limited due to the low photon efficiency and short decay period of the fluorescent signal
Invention patent CN106755460A "A single-base mutation detection method" discloses a method for detecting single-base mutations in nucleic acids by hybridization capture. The technical path of probe separation and fluorescence signal output. The purpose of magnetic separation is to transfer the nucleic acid sequence to be tested from the liquid phase of the sample to the artificial buffer. The target nucleic acid sequence has been separated from the magnetic particles during detection. The solution also has the characteristic that the fluorescent signal decays and weakens with time, and at the same time, the magnetic particles are separated from the target nucleic acid sequence during detection, which limits the applicable scenarios of this technical solution
Patent CN107058584A "A Nucleic Acid Hybridization Chemiluminescence Detection Method" achieves nucleic acid hybridization and luminescence detection by linking capture probes to microspheres of organic substrates such as polystyrene. Although this scheme uses signal amplification technology at the signal end However, at the capture end, there is the defect that microspheres with organic matter as the capture matrix are inconveniently separated from the liquid phase, and it is also difficult to achieve fully automatic detection
Patent CN101351564B "Detecting Nucleic Acids by Target-Specific Hybridization Capture Method" provides a hybridization capture detection method similar to the CN107058584A carrier, the capture carrier used is still organic microspheres, and the signal output provides fluorescence, gold labeling There are three pathways catalyzed by substances and enzymes, and the separation of microspheres from the liquid phase is also inconvenient.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid liquid-phase hybridization capture and detection method based on magnetic separation and enzyme catalysis
  • Nucleic acid liquid-phase hybridization capture and detection method based on magnetic separation and enzyme catalysis
  • Nucleic acid liquid-phase hybridization capture and detection method based on magnetic separation and enzyme catalysis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Detection of Toxigenic Escherichia coli ST Plasmid DNA Sequence Using a Pair of Probes

[0057] Search the nucleic acid sequence of toxigenic Escherichia coli from the NCBI website, perform sequence alignment, and design probes in specific sequence regions. The sequence of the probe 1 designed in this embodiment is as follows: AAAGGGAACTGTTTAGTTCCCTT, and the sequence of the designed probe 2 is as follows: TGTAATCCTGCTTGTACCGGGTGC.

[0058] When synthesizing probe 1, modify digoxin, prepare digoxin-AAAGGGAACTGTTTAGTTCCCTT, mix 1 OD of digoxin-modified probe 1 with 1 mg of digoxin antibody-modified magnetic particles, and pass the probe through digoxin - The specific reaction of the digoxin antibody is connected to the magnetic particles, and after 60 minutes of reaction at room temperature, magnetic separation is carried out under the force of a magnetic field to complete the preparation of magnetic capture probes, which are stored in TE buffer to avoid contamination an...

Embodiment 2

[0061] Detection of Influenza Virus Type B RNA Nucleic Acid Sequence Using Multi-probe Combination Magnetic Separation Hybridization Capture Chemiluminescence

[0062] Design the probe combination of influenza virus type B as follows:

[0063] Probe 1: Digoxigenin-GTAGTAACATCCAATGCAGATCGAAT;

[0064] Probe 2: Digoxigenin-GCACCAGGAGGACCCTACA;

[0065] Probe 3: Biotin-CCTGYCGGGTTCGGTAACA;

[0066] Probe 4: Biotin-GGTGARCGCGTGGTGTG;

[0067] Preparation of magnetic separation probes: Add 10 ug of 100 nm magnetic particles modified with anti-digoxigenin antibody to a centrifuge tube, add 2 nmol each of probe 1 and probe 2, mix at room temperature for 30 minutes, and collect magnetic particles by magnetic separation.

[0068] Extraction of RNA nucleic acid by magnetic bead method: Take two centrifuge tubes, add 50uL of influenza A H1N1 virus culture (negative control) and 50uL of influenza B virus culture (positive control) respectively, add 350uL of lysate to each, and vortex unt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for carrying out magnetic separation capture after nucleic acid liquid-phase hybridization and carrying out signal amplification detection by utilizing a bio-enzyme catalysis substrate. The method comprises two core elements of magnetic separation and enzyme catalysis. According to the magnetic separation element, a double-stranded complex after nucleic acid hybridization is captured from a liquid phase under the action of magnetic field force through a probe connected to a magnetic microparticle, and specific enrichment is performed on a target nucleic acid sequence to be detected; according to the enzyme catalysis element, a signal is amplified through the bio-enzyme catalysis substrate connected to the probe, so as to judge whether the target nucleic acid sequence to be detected exists or not. The target nucleic acid sequence can be a PCR amplification product and can also be nucleic acid which is not amplified. One of the core values of the invention is that a full-automatic nucleic acid detection device is developed by matching with the method, so that seamless joint of full-automatic nucleic acid extraction and full-automatic nucleic acid detection can be realized, and complete full-automatic nucleic acid detection is realized.

Description

technical field [0001] The invention relates to a nucleic acid liquid-phase hybridization capture detection method. The method is realized by two core elements of magnetic separation and enzymatic catalysis. The magnetic separation is achieved by connecting the magnetic particles with the hybridization probe nucleic acid sequence. After the probe and the target nucleic acid sequence base are complementary to form a hybrid, magnetic The collection of microparticles achieves the purpose of selectively separating and enriching the target nucleic acid sequence from the liquid phase. At the same time, another or more nucleic acid probes that are complementary to other parts of the target nucleic acid sequence are connected to the biological enzyme. After hybridization, the biological enzyme and the target nucleic acid sequence are connected together, and the signal is transmitted through the enzyme-catalyzed substrate color development or luminescence. Amplification can achieve hi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6834C12N15/11
CPCC12Q1/6834C12Q2563/143C12Q2563/149
Inventor 段江波
Owner 段江波