Nucleic acid liquid-phase hybridization capture and detection method based on magnetic separation and enzyme catalysis
A liquid phase hybridization and detection method technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of poor sample detection flexibility, limited sensitivity, prolonged reaction time, etc. Reduce technical difficulty and condition requirements, improve sensitivity, and achieve specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Detection of Toxigenic Escherichia coli ST Plasmid DNA Sequence Using a Pair of Probes
[0057] Search the nucleic acid sequence of toxigenic Escherichia coli from the NCBI website, perform sequence alignment, and design probes in specific sequence regions. The sequence of the probe 1 designed in this embodiment is as follows: AAAGGGAACTGTTTAGTTCCCTT, and the sequence of the designed probe 2 is as follows: TGTAATCCTGCTTGTACCGGGTGC.
[0058] When synthesizing probe 1, modify digoxin, prepare digoxin-AAAGGGAACTGTTTAGTTCCCTT, mix 1 OD of digoxin-modified probe 1 with 1 mg of digoxin antibody-modified magnetic particles, and pass the probe through digoxin - The specific reaction of the digoxin antibody is connected to the magnetic particles, and after 60 minutes of reaction at room temperature, magnetic separation is carried out under the force of a magnetic field to complete the preparation of magnetic capture probes, which are stored in TE buffer to avoid contamination an...
Embodiment 2
[0061] Detection of Influenza Virus Type B RNA Nucleic Acid Sequence Using Multi-probe Combination Magnetic Separation Hybridization Capture Chemiluminescence
[0062] Design the probe combination of influenza virus type B as follows:
[0063] Probe 1: Digoxigenin-GTAGTAACATCCAATGCAGATCGAAT;
[0064] Probe 2: Digoxigenin-GCACCAGGAGGACCCTACA;
[0065] Probe 3: Biotin-CCTGYCGGGTTCGGTAACA;
[0066] Probe 4: Biotin-GGTGARCGCGTGGTGTG;
[0067] Preparation of magnetic separation probes: Add 10 ug of 100 nm magnetic particles modified with anti-digoxigenin antibody to a centrifuge tube, add 2 nmol each of probe 1 and probe 2, mix at room temperature for 30 minutes, and collect magnetic particles by magnetic separation.
[0068] Extraction of RNA nucleic acid by magnetic bead method: Take two centrifuge tubes, add 50uL of influenza A H1N1 virus culture (negative control) and 50uL of influenza B virus culture (positive control) respectively, add 350uL of lysate to each, and vortex unt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


