Application of gene LJP1 for controlling growth period of rice

A rice growth period, gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve problems such as genetic analysis difficulties, and achieve the effect of strong adaptability

Active Publication Date: 2021-03-09
FUJIAN AGRI & FORESTRY UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reason for this is that genetic analysis of the basic vegetative growth phase is difficult, requiring s

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene LJP1 for controlling growth period of rice
  • Application of gene LJP1 for controlling growth period of rice
  • Application of gene LJP1 for controlling growth period of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Rice LJP1 gene cloning

[0036] 1. Rice material and targeting groups:

[0037] like figure 1 The indicated rice mutant ljp1 Obtained by the inventors by means of radiation mutagenesis, the original wild-type parent is the japonica rice variety Nipponbare. Will ljp1 The mutant was crossed with the wild-type variety DZ60, F 1 Generation selfing, get F2 population, at the rice heading stage according to ljp1 389 plants were selected as the mapping population for the mutant phenotype.

[0038] 2. Location using rice microsatellite markers LJP1 Gene:

[0039] The total DNA of rice was rapidly extracted by the rice micro-method. Take about 0.3 grams of rice leaves, put them into a 1.5ml centrifuge tube, freeze them with liquid nitrogen, and extract DNA quickly. The obtained DNA is dissolved in 100 ul ultrapure water. Using the positioning method of DNA pool, preliminary positioning LJP1 Gene. According to the published rice microsatellite gene...

Embodiment 2

[0042] Embodiment 2 complementary experiment

[0043] 1. Construct the complementary experimental vector.

[0044] Nipponbare LJP1 The sequence of the gene was constructed using the pCAMBIA1300 vector with added restriction sites as image 3 Complementation experimental vectors for the indicated candidate genes. The specific process of vector construction is: in the candidate LJP1 Design a pair of primers with enzyme cutting sites for the gene region and the promoter region, use high-fidelity enzymes to perform high-fidelity PCR amplification and sequencing, select clones with completely correct sequences, and after enzyme digestion and ligation, construct the following: image 3 The indicated vector was then transformed into Agrobacterium. The DNA sequence of the complementary vector is 3420bp. The primers used to amplify the DNA sequence of the complementation experiment are: forward primer sequence: CGGAATTCATTTCTATGCGGTACAGTTTT, reverse primer sequence: CGGAATTCGTATTT...

Embodiment 3

[0047] Example 3 Cultivation of rice germplasm with long growth period, light insensitivity and high yield

[0048] Will ljp1The mutants were crossed with Zhonghua 11 and Zhonghua 15 respectively to obtain F1 generation. Taking Zhonghua 11 and Zhonghua 15 as recurrent parents, after multiple generations (more than 5 generations) of backcrossing, as shown in Table 1, they were screened out under natural short-day conditions in winter in Sanya City, Hainan Province (about 10 h sunshine at the booting stage). / day) and planted under the natural long-sunlight conditions in Fuzhou City, Fujian Province in summer (about 14 h sunshine / day at the booting stage), it has the characteristics of long growth period, light insensitivity, many tillers, and high yield, but other traits are consistent with the backcross parent strain. At the same time, the total DNA of rice was rapidly extracted by the rice micro-method, and PCR was used to amplify the ljp1 The sequence of the mutation si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention belongs to the technical field of plant genetic engineering, discloses application of a gene LJP1 for controlling the growth period of rice, and particularly relates to cloning, functional verification and application of the gene for controlling the growth period of rice. The nucleotide sequence of the gene LJP1 is shown in a sequence table SEQ ID NO. 1, and the coded amino acid sequence of the gene LJP1 is shown in a sequence table SEQ ID NO. 2. The gene LJP1 determines the basic vegetative growth period and the photosensitivity of rice, and therefore the yield of rice is influenced. The gene is used for creating new germplasm for rice breeding, the planting area and season of rice varieties are enlarged, the yield and quality of rice are improved, and the gene has good application prospects.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, it involves a method of using gene mapping combined with genome resequencing technology to clone genes that control the growth period of rice. LJP1 ( Long-Juvenile Phase ), and the function of the gene was verified by transgene complementation experiment. At the same time, it also involves using the gene to create new germplasm for rice breeding, expand the planting area and season of rice varieties, and improve the yield and quality of rice, which has a good application prospect. Background technique [0002] Rice is one of the main food crops in my country and even in the world, and the yield of rice is closely related to flowering time. Heading date (that is, the number of days from sowing to heading) is one of the most important agronomic traits of crops, which determines the suitable planting area, planting season and farming method of crops. The heading date of r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8261
Inventor 段远霖吴为人张玉丹蔡正正陈志伟
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap