Mutant of CE (cellobiose 2-epimerase) and application of mutant

A technology of epimerase and cellobiose, applied in the field of enzyme engineering, can solve the problems of low conversion rate of lactulose and low enzyme activity

Active Publication Date: 2021-04-23
JIANGNAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Aiming at the current problems of low cellobiose isomerase activity and low lactulose conversion rate, the present invention transforms the cellobiose epimerase (DtCE) derived from Streptococcus thermophilus Dictyoglomusthermophilum, To obtain mutants with improved enzyme activity and lactulose conversion rate, and apply the mutants to the production of lactulose to increase the production of lactulose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant of CE (cellobiose 2-epimerase) and application of mutant
  • Mutant of CE (cellobiose 2-epimerase) and application of mutant
  • Mutant of CE (cellobiose 2-epimerase) and application of mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1: Construction and transformation of recombinant plasmid pET-20b(+)-dtce

[0053] By PCR (primer F: GATATA CATATG GATCTTAAACAT, R: GGTG CTCGAG AATGCGACGAATGACTTCAAGATA) amplifies the coding gene dtce of DtCE (the nucleotide sequence is shown in SEQ ID NO.2), and after NdeI and XhoI double digestion, it is connected to pET-20b(+) to obtain the recombinant plasmid pET-20b(+ )-dtce. Use the pET-20b(+)-dtce recombinant plasmid as a template to perform error-prone PCR on the dtce gene, and the product is passed through Megaprimer PCR of Whole Plasmid (MEGAWHOP) (see references for details: Miyazaki K, MEGAWHOP cloning: a method of creating random mutagenesis via megaprimer PCR of whole plasmids, Methods Enzymol.2011; 499:399-406) were connected to the plasmid pET-20b(+) to construct a mutant gene library, which was transformed into E.coliBL21(DE3).

Embodiment 2

[0054] Example 2: Screening of dominant mutants

[0055] Pick the monoclonal transformant on the plate into a 96-well plate, culture at 37°C, 700rpm for 6-12h, transfer to a 96-well plate containing 800μL TB, 37°C, 700rpm, 4h, adjust to 25°C, 0.1-5mM IPTG, 700rpm, 24h. The bacteria were collected by centrifugation, and 100 μL of supernatant was obtained by breaking the wall, and 50 μL of 2500 g / mL lactose solution was added, and reacted at 80° C. for 70 minutes. Take 50 μL of the reaction solution, add 75 μL of chromogen (2.5% cysteine ​​hydrochloride and 0.08% tryptophan dissolved in 75% sulfuric acid), and detect the absorbance at 46°C for 70 min at 518 nm. Single clones with greater absorbance than wild type were selected, sequenced and verified in the next step.

Embodiment 3

[0056] Embodiment 3: DtCE and mutant shake flask fermentation

[0057] Inoculate DtCE and mutants with high yield of lactulose screened in Example 2 in LB medium, culture at 37°C for 6-12 hours, then transfer to 50-2000mL TB fermentation medium with 5% inoculum , put it to 37℃, 200rpm constant temperature culture for 2h, in the cell OD 600 Turn to 25°C and 200rpm at 0.5-1.0, add 0.1mM-5mM IPTG to induce fermentation for 24h by shaking the flask. After the fermentation is finished, the fermentation liquid is ultrasonically broken and then centrifuged, and the supernatant is the recombinant enzyme.

[0058] The measured DtCE enzyme activity is 7.9U / mL, and the mutant enzyme activity is 8.6-18.0U / mL. The results of protein electrophoresis show that there is a band consistent with the theoretical molecular weight at 43kDa ( figure 2 ).

[0059] Table 1 Mutant fermentation enzyme activity

[0060]

[0061]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
densityaaaaaaaaaa
refractive indexaaaaaaaaaa
Login to view more

Abstract

The invention discloses a mutant of CE (cellobiose 2-epimerase) and an application of the mutant, and belongs to the technical field of enzyme engineering. The CE derived from thermophilic anaerobic bacteria Dictyoglomusthermophilum is subjected to directed evolution, the obtained mutant can still have the performance of converting lactose into lactulose, the enzyme activity and the substrate conversion rate are remarkably increased, and under the condition of the same enzyme adding amount, the lactulose conversion rate can reach 58.2% at most and is increased by 35.35% compared with that of a wild type lactulose mutant. Good industrial application performance is realized.

Description

technical field [0001] The invention discloses a cellobiose epimerase mutant and an application thereof, belonging to the technical field of enzyme engineering. Background technique [0002] Lactulose (4-O-β-D-galactopyranosyl-D-fructose, Lactulose), also known as isomerized lactose, lactulose or galactose, is a combination of galactose and fructose through β-1,4-glycosidic bonds. become. The molecular formula of lactulose is C 12 h 22 o 11 , and lactose are isomers. The finished product of lactulose is light yellow transparent viscous body, slightly sweet, and its crystal is white irregular powder with a density of 1.32g / cm 3 , The solubility in water is 76.4% (30°C), and the refractive index is 1.45-1.47. The sweetness of lactulose is equivalent to that of lactose, which is 48%-60% of that of sucrose. It has a cool taste, low viscosity, low calorific value, is safer and more stable, and is less prone to Maillard reaction. [0003] Due to its special physiological ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/90C12N15/61C12N15/70C12N1/21C12P19/24C12P19/12C12R1/19
CPCC12N9/90C12N15/70C12P19/24C12P19/12C12Y501/03011
Inventor 吴敬刘展志张颖
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap