Mutant of CE (cellobiose 2-epimerase) and application of mutant
A technology of epimerase and cellobiose, applied in the field of enzyme engineering, can solve the problems of low conversion rate of lactulose and low enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Embodiment 1: Construction and transformation of recombinant plasmid pET-20b(+)-dtce
[0053] By PCR (primer F: GATATA CATATG GATCTTAAACAT, R: GGTG CTCGAG AATGCGACGAATGACTTCAAGATA) amplifies the coding gene dtce of DtCE (the nucleotide sequence is shown in SEQ ID NO.2), and after NdeI and XhoI double digestion, it is connected to pET-20b(+) to obtain the recombinant plasmid pET-20b(+ )-dtce. Use the pET-20b(+)-dtce recombinant plasmid as a template to perform error-prone PCR on the dtce gene, and the product is passed through Megaprimer PCR of Whole Plasmid (MEGAWHOP) (see references for details: Miyazaki K, MEGAWHOP cloning: a method of creating random mutagenesis via megaprimer PCR of whole plasmids, Methods Enzymol.2011; 499:399-406) were connected to the plasmid pET-20b(+) to construct a mutant gene library, which was transformed into E.coliBL21(DE3).
Embodiment 2
[0054] Example 2: Screening of dominant mutants
[0055] Pick the monoclonal transformant on the plate into a 96-well plate, culture at 37°C, 700rpm for 6-12h, transfer to a 96-well plate containing 800μL TB, 37°C, 700rpm, 4h, adjust to 25°C, 0.1-5mM IPTG, 700rpm, 24h. The bacteria were collected by centrifugation, and 100 μL of supernatant was obtained by breaking the wall, and 50 μL of 2500 g / mL lactose solution was added, and reacted at 80° C. for 70 minutes. Take 50 μL of the reaction solution, add 75 μL of chromogen (2.5% cysteine hydrochloride and 0.08% tryptophan dissolved in 75% sulfuric acid), and detect the absorbance at 46°C for 70 min at 518 nm. Single clones with greater absorbance than wild type were selected, sequenced and verified in the next step.
Embodiment 3
[0056] Embodiment 3: DtCE and mutant shake flask fermentation
[0057] Inoculate DtCE and mutants with high yield of lactulose screened in Example 2 in LB medium, culture at 37°C for 6-12 hours, then transfer to 50-2000mL TB fermentation medium with 5% inoculum , put it to 37℃, 200rpm constant temperature culture for 2h, in the cell OD 600 Turn to 25°C and 200rpm at 0.5-1.0, add 0.1mM-5mM IPTG to induce fermentation for 24h by shaking the flask. After the fermentation is finished, the fermentation liquid is ultrasonically broken and then centrifuged, and the supernatant is the recombinant enzyme.
[0058] The measured DtCE enzyme activity is 7.9U / mL, and the mutant enzyme activity is 8.6-18.0U / mL. The results of protein electrophoresis show that there is a band consistent with the theoretical molecular weight at 43kDa ( figure 2 ).
[0059] Table 1 Mutant fermentation enzyme activity
[0060]
[0061]
PUM
| Property | Measurement | Unit |
|---|---|---|
| density | aaaaa | aaaaa |
| refractive index | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


