A kind of p-nitrobenzyl esterase mutant and its application

A technology for nitrobenzyl esterase and mutants, which is applied in the field of p-nitrobenzyl esterase mutants and applications, can solve the problem of low stereoselectivity, and achieve the effects of improved stereoselectivity and good industrial application performance

Active Publication Date: 2022-05-27
ANHUI FENGLE PERFUME +1
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] An existing esterase derived from Bacillus subtilis has good advantages in hydrolyzing dl-menthyl acetate chiral resolution to prepare l-menthol, including fast reaction rate and large amount of substrate, but its disadvantage is that the enzyme The stereoselectivity of the enzyme is not high, and it is necessary to add co-solvents such as ethanol or butanol to improve the catalytic rate and catalytic stereoselectivity of the enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of p-nitrobenzyl esterase mutant and its application
  • A kind of p-nitrobenzyl esterase mutant and its application
  • A kind of p-nitrobenzyl esterase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Clonal expression of wild-type esterase PNB gene

[0031] Esterase PNB gene of B.subtilis CGMCC No.17904 genome was amplified by PCR technology. The amplification primers are PNB-F and PNB-R.

[0032] PNB-F:GAAGGAGATATACCATGGGCACTCATCAAATAGTAACGAC

[0033] PNB-R:CGGAGCTCGAATTCGGATCCTTATTCTCCTTTTGAAGGGAATAG

[0034] PcR amplification of the resulting PNB gene fragments, isolated and purified by agarose gel electrophoresis, are used for ligation reactions. Plasmid pET-28a was extracted, the plasmid was double-digested with the restriction nucleic acid endonuclease Ncol / BamHI, and the agarose gel electrophoresis was separated and purified for ligation reaction. The ClonExpress II One StepCloning Kit was used to ligate purified PNB gene fragments and purified linearized pET-28a plasmids. Take 10 μL of the ligation product, mix with 100 μL of E. coli BL21 (DE3) competent cells, leave it in an ice bath for 30 min, and heat-hit 90s in a 42 °C water bath. Coat the compet...

Embodiment 2

[0036] Example 2: Wild-type esterase PNB catalyzed hydrolyzed dl- menthyl acetate to prepare l- menthol activity analysis

[0037] Take the wild-type esterase PNB bacterium prepared by the above method 2 mL, 10000 × g, 10 min centrifugation to collect cells, resuspend the cells in 1 mL pH8.0 of 200 mM phosphoric acid buffer, take two parts of the resuspensive agent, one part add 10% (v / v) n-butanol as a co-solvent (the co-solvent type has been optimized), the other part adds an equal amount of pure water as the control, add 20 μL of dl-menthyl acetate, and catalyze the shaking of the metal bath at 30 °C and 1200 rpm for 2h. Catalytic fluids are used for GC analysis.

[0038] The GC analysis results of the catalytic solution are shown in Table 1, and under the catalytic system of the addition of organic solvent n-butanol, the stereoselectivity of the dl-menthyl acetate substrate was increased from 70.13% to 92.01%, so the stereoselectivity of the substrate was significantly improve...

Embodiment 3

[0044] Example 3: Esterase PNB mutation site design and mutant construction and screening

[0045] In order to improve the stereoselectivity of wild-type esterase PNB in a non-solvent system, the site-directed mutation site of PNB was selected by computer-aided design. Isomeric modeling of esterase PNB from strain B.subtilis CGMCC No.17904 has been reported based on the reported esterase crystal structure (PDB ID: 1QE3) of Bacillus subtilis. The three-dimensional structure analysis software and molecular docking software of proteins are used for simulation analysis. Considering the docking results of esterase and substrate, the characteristics of the substrate binding pocket of the enzyme, the structural characteristics of the enzyme identification substrate stereoselection, and the catalytic mechanism of the enzyme, the final prediction of the function of the phenylalanine residue at the 315th site of the amino acid sequence SEQ IDNO:2 is that the site is at the entrance of the e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a p-nitrobenzyl esterase mutant and its application in enzymatically catalyzing the chiral resolution of dl-menth ester to prepare l-menthol. The mutant is obtained by performing site-directed saturation mutation at position 315 of the wild-type p-nitrobenzyl esterase whose amino acid sequence is shown in SEQ ID NO:2. The beneficial effects of the present invention are mainly reflected in: 1. The esterase mutant of the present invention does not need to add a cosolvent, and the enzyme catalytic activity maintains a high level; 2. Under the no cosolvent system, the stereoselectivity of the mutant enzyme catalysis is significantly improved compared with the wild type . The mutant enzyme was used to catalyze the reaction after being overexpressed in Escherichia coli, and 10-200 g / L of dl-menthyl acetate was used as a substrate for hydrolysis and resolution to prepare l-menthol. The results showed that l-menthyl acetate Substrate conversion >70%, ee for product l-menthol p Values ​​>95%, showing good performance for industrial applications.

Description

(1) Technical fields [0001] The present invention relates to a pair of nitrobenzylsterase mutants and their coding genes, and their application in the preparation of l- menthol in the preparation of l- menthol by enzyme catalyzing chiral separation of dl- menthyl esters. (2) Background technology [0002] Menthol is currently the largest demand for cyclic monoterpenesenol fragrance, it has a total of 8 kinds of isomers, of which l-menthol has a unique mint aroma and cooling effect, with excitement, sterilization and analgesia, antipruritic, aromatic cool and other functions, making it in various industries have a very wide range of applications, such as food, tobacco, cosmetics, oral health and other products. It is also widely used in medicines such as analgesics and local anesthetics, as well as precursors and auxiliary reagents for chiral compound synthesis. [0003] L-menthol production methods include plant extraction method, chemical synthesis method and biological enzyme c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/18C12N15/55C12P17/16
CPCC12N9/18C12Y301/01C12P17/162
Inventor陈小龙王广强金晓胡军陆跃乐张翼轸朱林江陈志钢陈翰驰田雯朱俊峰
OwnerANHUI FENGLE PERFUME