A kind of p-nitrobenzyl esterase mutant and its application
A technology for nitrobenzyl esterase and mutants, which is applied in the field of p-nitrobenzyl esterase mutants and applications, can solve the problem of low stereoselectivity, and achieve the effects of improved stereoselectivity and good industrial application performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Clonal expression of wild-type esterase PNB gene
[0031] Esterase PNB gene of B.subtilis CGMCC No.17904 genome was amplified by PCR technology. The amplification primers are PNB-F and PNB-R.
[0032] PNB-F：GAAGGAGATATACCATGGGCACTCATCAAATAGTAACGAC
[0033] PNB-R：CGGAGCTCGAATTCGGATCCTTATTCTCCTTTTGAAGGGAATAG
[0034] PcR amplification of the resulting PNB gene fragments, isolated and purified by agarose gel electrophoresis, are used for ligation reactions. Plasmid pET-28a was extracted, the plasmid was double-digested with the restriction nucleic acid endonuclease Ncol / BamHI, and the agarose gel electrophoresis was separated and purified for ligation reaction. The ClonExpress II One StepCloning Kit was used to ligate purified PNB gene fragments and purified linearized pET-28a plasmids. Take 10 μL of the ligation product, mix with 100 μL of E. coli BL21 (DE3) competent cells, leave it in an ice bath for 30 min, and heat-hit 90s in a 42 °C water bath. Coat the compet...
Embodiment 2
[0036] Example 2: Wild-type esterase PNB catalyzed hydrolyzed dl- menthyl acetate to prepare l- menthol activity analysis
[0037] Take the wild-type esterase PNB bacterium prepared by the above method 2 mL, 10000 × g, 10 min centrifugation to collect cells, resuspend the cells in 1 mL pH8.0 of 200 mM phosphoric acid buffer, take two parts of the resuspensive agent, one part add 10% (v / v) n-butanol as a co-solvent (the co-solvent type has been optimized), the other part adds an equal amount of pure water as the control, add 20 μL of dl-menthyl acetate, and catalyze the shaking of the metal bath at 30 °C and 1200 rpm for 2h. Catalytic fluids are used for GC analysis.
[0038] The GC analysis results of the catalytic solution are shown in Table 1, and under the catalytic system of the addition of organic solvent n-butanol, the stereoselectivity of the dl-menthyl acetate substrate was increased from 70.13% to 92.01%, so the stereoselectivity of the substrate was significantly improve...
Embodiment 3
[0044] Example 3: Esterase PNB mutation site design and mutant construction and screening
[0045] In order to improve the stereoselectivity of wild-type esterase PNB in a non-solvent system, the site-directed mutation site of PNB was selected by computer-aided design. Isomeric modeling of esterase PNB from strain B.subtilis CGMCC No.17904 has been reported based on the reported esterase crystal structure (PDB ID: 1QE3) of Bacillus subtilis. The three-dimensional structure analysis software and molecular docking software of proteins are used for simulation analysis. Considering the docking results of esterase and substrate, the characteristics of the substrate binding pocket of the enzyme, the structural characteristics of the enzyme identification substrate stereoselection, and the catalytic mechanism of the enzyme, the final prediction of the function of the phenylalanine residue at the 315th site of the amino acid sequence SEQ IDNO:2 is that the site is at the entrance of the e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More