Method for successively preparing icariside II and icaritin by taking icariin as raw material

A technology of icariin and icariin, applied in sugar derivatives, organic chemistry, fermentation, etc., can solve the problem of low conversion rate of icariin II, high difficulty in separation and purification, and difficulty in large-scale preparation and other issues, to achieve the effect of low equipment requirements, lower production costs, and simple production operations

Pending Publication Date: 2021-08-06
北京岳达生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Experiments have found that when icariin is hydrolyzed by acid, the breaking speed of the rhamnoside bond is 500 times that of the glucoside bond. Therefore, the conversion rate of icariin Ⅱ in the product of acid hydrolysis icariin is very low, so the high Pure icariin II is difficult to produce efficiently and on a large scale in this way
[0009] The direct acid hydrolysis of icariin to prepare icariin takes a long time, generally more than 72 hours, and the conversion rate varies with different acid hydrolysis, and the conversion rate of a single acid hydrolysis can only reach about 30%. The highest acid hydrolysis can only reach about 70%, and the pollution in production is relatively large, and the products are complicated, and the separation and purification are difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for successively preparing icariside II and icaritin by taking icariin as raw material
  • Method for successively preparing icariside II and icaritin by taking icariin as raw material
  • Method for successively preparing icariside II and icaritin by taking icariin as raw material

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1 Expression and purification of trans glycoside hydrolase

[0058] (1), construction of recombinant Escherichia coli

[0059] 1. Acquisition of trans-glycoside hydrolase gene

[0060] Activate the Clostridium stercorarium DSM8532 strain, collect the cells, and extract DNA according to the instructions of the Column Plasmid DNA Small Extraction Kit (purchased from Shanghai Sangong), and use the extracted DNA as a template for PCR.

[0061] The enzyme cutting sites used for constructing the plasmid are as follows: XhoI and BamHI;

[0062] The upstream and downstream primers are: Forwardprimer AGCTGAAGAACGCGGAATGA

[0063] Reverse primer AGCATTCGATGCCGAGCTTA

[0064] (All primers were synthesized by Shanghai Sangon)

[0065] PCR conditions of the gene: 30-35 cycles according to the following conditions, denaturation at 98°C for 10s, annealing at 65°C for 5s, extension at 72°C for 10s.

[0066] 2. Construction and transformation of recombinant plasmids

[...

Embodiment 2

[0072] Example 2 Preparation of Icariside II and Icaritin

[0073] Preparation process of icariside II and icariin figure 1 shown.

[0074] 1. Preparation of Icariside II

[0075] 1. Add 20Kg of methanol-treated icariin into a 500L stirring mixer, and simultaneously add 400L of 20% ethanol solution by volume, and stir evenly.

[0076] 2. Thoroughly homogenize the uniformly stirred material liquid through a high-pressure homogenizer, and the pressure of the high-pressure homogenizer is controlled at 30MP. After the homogenate is completed, it is discharged into a 500L temperature-controlled tilting reactor. Turn on the heating and stirring of the reactor to control the temperature at 55° C. and the pH at 6.

[0077] 3. After the temperature of the reaction system is stably controlled at 55°C, weigh 1Kg of the hydrolase prepared in Example 1, add 10Kg of pure water to dissolve completely, then slowly add it to the reaction system, stir for half an hour, stop stirring, and le...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for successively preparing icariside II and icaritin by taking icariin as a raw material. According to the method disclosed by the invention, two synergistic improved products of the icariin with high purity, namely the icariside II and the icaritin, can be finally obtained by using a low-content icariin raw material through a simple production process flow by an enzyme catalysis method. In order to solve the problems of low conversion rate and serious pollution when the icariin is used for producing the icaritin through common acid hydrolysis, a mode of combining enzyme catalysis hydrolysis and acid hydrolysis is creatively used, a traditional icaritin production process is greatly improved and optimized, and the conversion rate is improved to 99% or above. The production operation is simple, the equipment requirement is low, a solvent in the production process can be recycled, the method is green and environment-friendly, and large-scale production can be realized.

Description

technical field [0001] The invention relates to a method for successively preparing icariin II and icariin from icariin. The invention belongs to the technical field of chemical synthesis. Background technique [0002] Epimedium (scientific name: Epimedium brevicornu Maxim.) is the aerial part of the perennial herb of the genus Epimedium in the family Berberidaceae, and its stems and leaves can be used as commercial medicinal materials after drying. The types of Epimedium mainly include Epimedium cordata, Epimedium sagitta, Epimedium Wushan, Epimedium Korean and Epimedium vellus, which grow in forests, under bushes or in damp ravines , Distributed in Henan, Shanxi, Anhui, Hunan, Guangxi, Shaanxi, Ningxia, Gansu, Qinghai, Xinjiang and other provinces (autonomous regions). The main medicinal components of Epimedium are flavonoids, with a content of about 1.01% to 8.81%. At present, more than 50 kinds of flavonoids have been isolated. Studies have found that 8 active prenyl ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/60C07H17/07C07D311/30
CPCC12P19/60C07H17/07C07D311/30
Inventor张天朱丽惠王力
Owner北京岳达生物科技有限公司