Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Triticum aestivum delavayi synthase THI1 gene and application thereof in plant resistance to Chinese wheat mosaic virus

A technique for synthesizing enzymes and wheat, applied in the field of plant genetic engineering

Active Publication Date: 2021-09-03
NINGBO UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no antiviral application of the thiazosynthase THI1 gene at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triticum aestivum delavayi synthase THI1 gene and application thereof in plant resistance to Chinese wheat mosaic virus
  • Triticum aestivum delavayi synthase THI1 gene and application thereof in plant resistance to Chinese wheat mosaic virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Wheat thiamine synthase gene cloning thiazol consultations

[0025] Firstly HiPure Plant RNA Mini Kit Plant RNA miniprep kit (the Magen) Total RNA was extracted Yangmai158 wheat leaves, the extracted total RNA quantification using 1μg to the First Strand cDNA SynthesisKit ReverTra Ace (TOYOBO) reverse transcription reagents cartridge and subjected to reverse transcription described with reference to the merchant, wheat used to amplify the complete cDNA reverse Transcription thiamine thiazol consultation synthase gene.

[0026] Primers were designed F: ATGGCAGCCATGGCCACCACC (SEQ ID NO: 3); R: GGCGTCCACGATGTCGCCGTT (SEQ ID NO: 4). Using KOD FX (TOYOBO) High Fidelity enzyme reverse transcriptase cDNA was cloned from a wheat thiamine thiazol consultation synthetase gene, the reaction conditions are set: 95 ℃ denaturation 5min, 95 ℃ 30sec, 56 ℃ 30sec, 72 ℃ 90sec, 40 cycles. The reaction system is: 2 × Buffer 12.5μL, 2mM dNTPs 2.5μL, forward primer F 0.5μL, the reverse primer R 0...

Embodiment 2

[0028] According to Example 1 primer sequence at the 5 'end of the primer respectively coupled gateway universal joint (GGGGACAAGTTTGTACAAAAAAGCAGGCTTC (SEQ ID NO: 5) / GGGGACCACTTTGTACAAGAAAGCTGGGTC (SEQ ID NO: 6)), to give added linker primers (forward and reverse primers They are F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAGCCATGGCCACCACC (SEQ ID NO: 7); R: GGGGACCACTTTGTACAAGAAAGCTGGGTCGGCGTCCACGATGTCGCCGTT (SEQ ID NO: 8)). Plus linker using primers wheat thiamine thiazol consultation synthase encoding gene, the same method as in Example 1, to obtain an amplified fragment plus linker. The amplified fragment by BP plus linker enzyme (Invitrogen) for the BP reaction, the reaction procedure as follows: after adding the protease treatment 1h 25 ℃ K1μL, and then for 10min at 37 ℃. The reaction system was: The amplified fragment plus linker 2μL, pDONR207 vector 1μL, BP Clonas Enzyme Mix 1μL, ddH 2 O 1μL. Construction onto the entry vector pDONR207, to obtain recombinant plasmid pDONR207...

Embodiment 3

[0030] The method of genetic transformation of wheat mediated by gene gun pGWB408-THI1 vector containing the gene sequence of thiamine thiazol consultation synthase transformed into wheat immature embryo, the following steps:

[0031] 1) Acquisition pollination 13-15 days immature wheat seeds (seed color made a little green vaginal discharge, a weak embryo formed slightly projecting portion, scutellum approximately 1cm), the immature embryos of 10% NaClO solution after sterilization was inoculated in SD2 medium, 24 ~ 26 ℃ placed in a dark environment culture;

[0032] 2) After culturing 7-8 Tian excellent Callus selection state, which is centrally located on the center of the dish containing 0.4M osmotic pressure medium, is placed in the range of approximately 38 immature 2.5cm in diameter embryogenic callus, osmotic pretreatment 4 ~ 6h;

[0033] 3) The plasmid pAHC20 load pGWB408-THI1 recombinant plasmid volume ratio of 1: 1 mixture, which is then wrapped together in the powder p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a triticum aestivum delavayi synthase THI1 gene and application of the triticum aestivum synthase THI1 gene to resistance of plants to Chinese wheat mosaic viruses, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the triticum aestivum delavayi synthase THI1 gene provided by the invention is shown as SEQ ID NO: 1. According to the present invention, the triticum aestivum delavayi synthase THI1 gene is transferred into a triticum aestivum plant, so that the triticum aestivum delavayi synthase THI1 gene is over-expressed in the plant, and the resistance of the transgenic triticum aestivum plant to the Chinese wheat mosaic virus is improved. Therefore, the invention provides application of the triticum aestivum delavayi synthase THI1 gene as well as the recombinant vector and the encoded protein of the gene in resisting the Chinese wheat mosaic virus in plants.

Description

Technical field [0001] The present invention belongs to the field of plant genetic engineering, particularly to a wheat thiazol consultation synthase THI1 Plant Resistance Gene and Its Application in Chinese wheat mosaic viruses. Background technique [0002] One of the important pathogen Chinese wheat mosaic virus (Chinese Wheat Mosaic Viruse, CWMV) is capable of causing wheat mosaic virus disease of our country, by the obligate parasitic plant roots of cereal and more slime molds (Ploymyxa graminis) spread. Since Polymyxa graminis spores with a strong resistance, on the one hand poisonous plurality cereal plants after infection myxomycetes the plants continue to replicate in the host body onset; graminis plurality hand when no poison so get a new pathogenic virus become infected when slime mold infected plants. So sick of soil containing CWMV can maintain long-term virulence, Shandong, Henan, Jiangsu and other wheat growing regions of the country have suffered the effects of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/82A01H5/00A01H6/46
CPCC12N9/13C12N15/8283C12Y208/0101
Inventor 杨锦羊健刘芃陈剑平
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products