Triticum aestivum delavayi synthase THI1 gene and application thereof in plant resistance to Chinese wheat mosaic virus
A technique for synthesizing enzymes and wheat, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Wheat thiamine synthase gene cloning thiazol consultations
[0025] Firstly HiPure Plant RNA Mini Kit Plant RNA miniprep kit (the Magen) Total RNA was extracted Yangmai158 wheat leaves, the extracted total RNA quantification using 1μg to the First Strand cDNA SynthesisKit ReverTra Ace (TOYOBO) reverse transcription reagents cartridge and subjected to reverse transcription described with reference to the merchant, wheat used to amplify the complete cDNA reverse Transcription thiamine thiazol consultation synthase gene.
[0026] Primers were designed F: ATGGCAGCCATGGCCACCACC (SEQ ID NO: 3); R: GGCGTCCACGATGTCGCCGTT (SEQ ID NO: 4). Using KOD FX (TOYOBO) High Fidelity enzyme reverse transcriptase cDNA was cloned from a wheat thiamine thiazol consultation synthetase gene, the reaction conditions are set: 95 ℃ denaturation 5min, 95 ℃ 30sec, 56 ℃ 30sec, 72 ℃ 90sec, 40 cycles. The reaction system is: 2 × Buffer 12.5μL, 2mM dNTPs 2.5μL, forward primer F 0.5μL, the reverse primer R 0...
Embodiment 2
[0028] According to Example 1 primer sequence at the 5 'end of the primer respectively coupled gateway universal joint (GGGGACAAGTTTGTACAAAAAAGCAGGCTTC (SEQ ID NO: 5) / GGGGACCACTTTGTACAAGAAAGCTGGGTC (SEQ ID NO: 6)), to give added linker primers (forward and reverse primers They are F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAGCCATGGCCACCACC (SEQ ID NO: 7); R: GGGGACCACTTTGTACAAGAAAGCTGGGTCGGCGTCCACGATGTCGCCGTT (SEQ ID NO: 8)). Plus linker using primers wheat thiamine thiazol consultation synthase encoding gene, the same method as in Example 1, to obtain an amplified fragment plus linker. The amplified fragment by BP plus linker enzyme (Invitrogen) for the BP reaction, the reaction procedure as follows: after adding the protease treatment 1h 25 ℃ K1μL, and then for 10min at 37 ℃. The reaction system was: The amplified fragment plus linker 2μL, pDONR207 vector 1μL, BP Clonas Enzyme Mix 1μL, ddH 2 O 1μL. Construction onto the entry vector pDONR207, to obtain recombinant plasmid pDONR207...
Embodiment 3
[0030] The method of genetic transformation of wheat mediated by gene gun pGWB408-THI1 vector containing the gene sequence of thiamine thiazol consultation synthase transformed into wheat immature embryo, the following steps:
[0031] 1) Acquisition pollination 13-15 days immature wheat seeds (seed color made a little green vaginal discharge, a weak embryo formed slightly projecting portion, scutellum approximately 1cm), the immature embryos of 10% NaClO solution after sterilization was inoculated in SD2 medium, 24 ~ 26 ℃ placed in a dark environment culture;
[0032] 2) After culturing 7-8 Tian excellent Callus selection state, which is centrally located on the center of the dish containing 0.4M osmotic pressure medium, is placed in the range of approximately 38 immature 2.5cm in diameter embryogenic callus, osmotic pretreatment 4 ~ 6h;
[0033] 3) The plasmid pAHC20 load pGWB408-THI1 recombinant plasmid volume ratio of 1: 1 mixture, which is then wrapped together in the powder p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

