Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof

A technology of thiolase and ketoacyl, which is applied in the fields of biology and genetic engineering, can solve the problems of high cost, chemical residues and unfriendly environment of plant extraction method

Active Publication Date: 2021-11-09
KUNMING UNIV OF SCI & TECH
View PDF20 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The cost of the plant extraction method is too high, which is obviously not suitable for commercialization and large-scale production; and although the chemical synthesis method can meet the demand in terms of output, it also has the disadvantages of being unfriendly to the environment, residual chemical substances, and less active than natural carotenoids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof
  • 3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof
  • 3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: From Rhodosporidium ( Rhodosporidium kratochvilovae ) 3-ketoacyl-CoA thiolase gene isolated from YM25235 RkACAA1 The nucleotide sequence and the construction of the overexpression vector pRHRkACAA1-1

[0018] The total RNA of Rhodosporidium YM25235 was extracted by UNlQ-10 Column Trizol Total RNA Extraction Kit (Product No.: SK1321) from Sangon Bioengineering (Shanghai) Co., Ltd. R212-02) HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) was used for reverse transcription to synthesize cDNA, and 1 μL of cDNA was used as a template for polymerase chain reaction. RkACAA1-1 Sequence, design specific primers RkACAA1-1-F and RkACAA1-1-R, use the cDNA template obtained above to carry out PCR amplification on a PCR machine (Beijing Liuyi Biotechnology Co., Ltd.), and the primers, components and amplification used in the reaction are used. The additional conditions are as follows:

[0019] RkACAA1-1-F: 5'- ATCACTCACCATGGCGGATCC TATGTCTCTCACGAACGCCG -3' (...

Embodiment 2

[0027] Example 2: RkACAA1-1 Effects of gene overexpression on carotenoid synthesis in Rhodosporidium YM25235

[0028] 1. Transform Rhodosporidium YM25235

[0029] Pick the single clone of DH5α strain successfully transformed into the correct recombinant vector pRHRKACAA1-2 and insert it into LB liquid medium (containing 100 µg / mL spectinomycin) for overnight culture, extract the plasmid (OMEGA Plasmid Mini Kit I, OMEGA, USA), put it in Store at -20 °C for later use; pick a single colony of Rhodosporidium YM25235 and inoculate it in 5 mL of YPD liquid medium, and shake at 30 °C and 200 rpm overnight; transfer the overnight cultured bacterial solution to 1% of the inoculum. In 50 mL of YPD liquid medium, shake at 30 °C and 200 rpm to culture to the OD of the bacterial liquid 600 To 0.5, the culture medium was centrifuged at 4°C and 4500 rpm for 5 min to collect bacteria; the bacteria were washed with previously prepared citric acid buffer (30 mM citric acid, 83 mM sodium citra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 3-ketoacyl-CoA thiolase gene RkACAA1-1. A nucleotide sequence of the 3-ketoacyl-CoA thiolase gene RkACAA1-1 is shown as SEQ ID NO: 1, and an amino acid sequence coded by the gene is shown as SEQ ID NO: 2. The gene is separated from rhodosporidium kratochvilovae YM25235, the gene is transformed into the rhodosporidium kratochvilovae YM25235, and an experimental result shows that the overexpression of the 3-ketoacyl-CoA thiolase gene RkACAA1-1 can cause the increase of total carotenoids in a rhodosporidium kratochvilovae YM25235 strain. According to the 3-ketoacyl-CoA thiolase gene RkACAA1-1 and the application thereof, the rhodosporidium kratochvilovae is modified by a genetic engineering means to increase the content of the carotenoids, so that good application prospects and economic benefits are provided for industrial production of the carotenoids, and a foundation is laid for large-scale commercial production of the carotenoids.

Description

technical field [0001] The invention belongs to the technical field of biology and genetic engineering, and relates to a 3-ketoacyl-CoA thiolase gene RkACAA1-1 and its application in promoting microbial production of carotenoids. Background technique [0002] Carotenoids are an important class of natural pigments and are isoprene polymers containing 40 carbon atoms. According to the molecular composition of carotenoids, they can usually be divided into two categories, one is carotenes whose chemical structure does not contain oxygen elements and only contains hydrocarbon elements, such as α-carotene, β-carotene and Lycopene; a class of xanthophylls whose chemical structure contains oxygen-containing functional groups such as hydroxyl, ketone, carboxyl, methoxy, etc., such as zeaxanthin, lutein and astaxanthin. At present, more than 800 kinds of natural carotenoids have been found in nature, which widely exist in higher plants, algae, fungi and bacteria. [0003] Carotenoi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/81C12N1/19C12P23/00C12R1/645
CPCC12N9/1029C12N15/815C12P23/00C12Y203/01016
Inventor 张琦陈功水魏云林季秀玲
Owner KUNMING UNIV OF SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More