Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system
A Salmonella and kit technology, which is applied in the field of kits for rapid detection of Salmonella, can solve the problems of unstable colloidal gold detection results, high detection temperature, and long detection time, and achieve short detection time, high sensitivity, and strong specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 RPA primer design screening and amplification system determination
[0033] Download the whole genome sequence of Salmonella (CMCC50041) from the GenBank database, select the specific fragment of Salmonella, use the Primer-BLAST tool on the NCBI web page to search for this specific fragment to confirm the homology of this fragment in Salmonella, and determine the amplification target is Fim Y Gene: According to the target sequence design, a series of primer pairs meeting the RPA primer design principles were obtained, after a series of preliminary detection and screening. The primer screening results are as follows:
[0034] Salmonella specific primer set, amplified fragment 284bp:
[0035] Upstream primer: 5'-CCCAGCCATACGGATAAACTGTGTTATAGCGG-3';
[0036] Downstream primer: 5'-CTCAGGCAATAATTACAACTGACAACTACCTC-3';
[0037] After determining the optimal primer set, the RPA amplification system was established, and conditions such as primer concentration, dNTP...
Embodiment 2
[0049] Example 2 crRNA screening and CRISPR / cas12a system optimization
[0050] In the amplified 284bp fragment, comparing the differences between Salmonella species, a 21bp fragment of TTTV-(PAM site) that meets the detection requirements of cas12a was selected and determined as the target of the crRNA probe, and the specific target nucleotide sequence It is 5'-AATCCACAAAGAAATGTCATC-3', and the corresponding crRNA is designed and synthesized according to the specific target nucleotide.
[0051] The crRNA sequence is as follows:
[0052] UAAUUUCUACUAAGUGUAGAUAAUCCACAAAGAAAUGUCAUC
[0053] (1) cas12a / crRNA ratio
[0054] Different ratios of cas12a / crRNA were set to determine the optimal ratio conditions with different fluorescence brightness, and the final ratio was determined to be 1:1.
[0055] (2) cas12a / ssDNA fluorescent probe ratio
[0056] Different ratios of cas12a / ssDNA fluorescent probes were set to determine the optimal ratio conditions with different fluorescence...
Embodiment 3
[0059] Example 3 Establishment of RPA-CRISPR / cas12a method
[0060] (1) Salmonella culture and DNA extraction
[0061] Configure the solid medium inverted plate for single colony culture, and configure the liquid medium for the enrichment experiment. Resuscitate the purchased Salmonella species in liquid culture, and then streak culture a single colony on the plate, pick a single colony for liquid expansion culture, 200rpm, 37 ° C for 10-12h.
[0062] In order to ensure that the purity and concentration of the extracted genomic DNA are maintained at a high level, a kit is used for extraction. The specific operation steps are as follows:
[0063] 1. Take 1-5mL of bacterial culture solution, centrifuge at 10,000rpm (~11,500xg) for 1min, and aspirate the supernatant as much as possible.
[0064] 2. Add 200 μL buffer GA to the cell pellet and shake until the cell is completely suspended.
[0065] 3. Add 20 μL of Proteinase K solution to the tube and mix well.
[0066] 4. Add 2...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More