Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescence in-situ hybridization probe group for detecting BCR/ABL gene and application of fluorescence in-situ hybridization probe group

A fluorescence in situ hybridization and probe set technology, which can be used in DNA/RNA fragmentation, recombinant DNA technology, and the determination/inspection of microorganisms. It can solve the problems of low probe specificity, low hybridization efficiency, and long hybridization time. , to achieve the effect of improved resolution, high sensitivity and strong specificity

Pending Publication Date: 2022-03-18
WUHAN YZY MEDICAL SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional commercial FISH probes mainly use BAC clones as probes for hybridization detection after fluorescent molecular labeling. Then, the probes prepared by BAC clones have some non-repetitive sequences, and the specificity of the probes is not high. Cot1-DNA is needed for detection. Non-blocking closed, and the probe fragments are generally too large, the length is between 200-500bp, the hybridization efficiency is low, and the hybridization time is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence in-situ hybridization probe group for detecting BCR/ABL gene and application of fluorescence in-situ hybridization probe group
  • Fluorescence in-situ hybridization probe group for detecting BCR/ABL gene and application of fluorescence in-situ hybridization probe group
  • Fluorescence in-situ hybridization probe group for detecting BCR/ABL gene and application of fluorescence in-situ hybridization probe group

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] This embodiment provides a method for preparing a BCR / ABL gene fluorescent in situ hybridization probe set, which specifically includes the following steps:

[0022] S1, based on the sequences of the BCR and ABL genes, design nucleotide sequences containing 45 bases in the 100kb region without repetitive sequences, set the Tm value of the probe at 50°C, and the GC content range of 40-60% , after discarding the sequence containing AAAA / TTTT / CCCC / GGGG, 3500 candidate probes were obtained, and after the whole gene (hg38) BLAST comparison analysis, a total of 2204 nucleotide sequences were finally obtained, as shown in Table 1 below ;

[0023] S2, add a 20bp tag sequence to the 5' end of each nucleotide sequence and a 20bp tag sequence to the 3' end to obtain a series of characteristic primers with tag sequences, wherein the 5' end tag sequence is : TAATACGACTCACTATAGGG, the 3' end tag sequence is: CCGCTGAGCAATAACTAGCA;

[0024] S3, using high-throughput chip synthesis te...

Embodiment 2

[0049] Embodiment 2 Normal people's peripheral lymphocyte droplet experiment

[0050] Materials: human peripheral blood lymphocyte culture medium, colchicine, hypotonic solution (0.4% KCl), fixative solution (methanol:acetic acid=3:1, volume ratio).

[0051] S1, cell culture and synchronization: take 0.4mL heparin anticoagulated whole blood (from the hospital) in human peripheral blood lymphocyte culture medium, mix well and culture in a constant temperature incubator at 37°C and 5% CO2 for 72h, and stop at For the first 4 hours, add colchicine to the medium to a final concentration (0.1 μg / mL) and continue culturing for 4 hours;

[0052]S2, collection and fixation: collect the medium, centrifuge at 500g for 5min, discard the supernatant, add 0.4% KCl hypotonic solution and incubate for 30min, then fix the cells with methanol-glacial acetic acid mixture, let stand at room temperature for 10min, centrifuge at 500g to pellet the cells , repeat the cell fixation step once, after...

Embodiment 3

[0059] Refer to the method in Example 2 to detect slides containing 50 metaphase lymphocytes, and the results are shown in Table 3 below. It can be seen that the FISH signal points of the BCR gene probe are all 99, and the sensitivity reaches 99%; ABL There are 99 FISH signal points of the gene probes, and the sensitivity reaches 99%.

[0060] Table 3 Sensitivity test results of probes

[0061]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of gene detection, in particular to a fluorescence in-situ hybridization probe set for detecting BCR / ABL genes and application of the fluorescence in-situ hybridization probe set. According to the invention, in a non-repetitive region of the BCR / ABL gene, on the basis of using as few probes as possible, the probe resolution is increased, a PCR (Polymerase Chain Reaction) doping method is also adopted in the preparation process to ensure that the product contains more fluorophores, and when the probe group is used for detecting the BCR / ABL gene, the cost is relatively low, and the hybridization of the probes can be completed in about 30 minutes.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a fluorescent in situ hybridization probe set for detecting BCR / ABL genes and its application. Background technique [0002] Leukemia is one of the high-incidence malignant tumors in China, among which chronic myeloid leukemia (CML) is a malignant clonal proliferative disease of the blood system that occurs in hematopoietic stem cells. In the blood cells of more than 90% of CML patients, the ABL proto-oncogene on the long arm of chromosome 9 translocates to the breakpoint concentration region (BCR) on the long arm of chromosome 22, forming a BCR / ABL fusion gene, which can be used as a CML typing diagnosis Based on the basis and a reliable indicator of curative effect evaluation, the BCR-ABL fusion protein encoded by the fusion gene has strong tyrosine kinase activity, can inhibit the adhesion and apoptosis of myeloid cells, and promote the transition of cells independent o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6841C12Q1/6811C12N15/11
CPCC12Q1/6886C12Q1/6841C12Q1/6811C12Q2600/112C12Q2600/156C12Q2563/107C12Q2531/113
Inventor 祝丹平魏亮马云飞董祥吴文雅
Owner WUHAN YZY MEDICAL SCI & TECH