Grifola frondosa UDP glucosyltransferase as well as coding gene and application thereof

A technology of glucosyl and transferase, applied in the fields of edible mushroom molecular biotechnology and genetic engineering

Pending Publication Date: 2022-03-22
JIANGSU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the synthetic pathways and catalytic properties of polysaccharide synthesis-related enzymes such as UDP-glucose pyrophosphorylase (UGP), UDP-glycosyltransferase (UGT) and glucan synthase (GLS) still need to be further studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Grifola frondosa UDP glucosyltransferase as well as coding gene and application thereof
  • Grifola frondosa UDP glucosyltransferase as well as coding gene and application thereof
  • Grifola frondosa UDP glucosyltransferase as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: the cloning of Grifola frondosa UDP glucosyltransferase coding gene

[0029] Grifola frondosa GF02 was collected by centrifugation (purchased from American type culture collection bank, American type culture collection, 60301 TM ) to cultivate mycelia, quickly add liquid nitrogen to grind into fine powder, and extract total RNA of Grifola frondosa by FungalTotalRNAIsolation Kit (SangonBiotech). Using PrimeScript TM RTreagentKitwithgDNAEraser (Takara) reagent instructions were used to synthesize cDNA.

[0030] In this example, according to the disclosed coding gene of Grifola frondosa UDP glucosyltransferase (GenBankaccessionnumber: OBZ67170), primers were designed for amplification, using the reverse transcription product cDNA as a template, the sequence ATGGTCAGGCTGCGGGTGAT TGT (SEQ ID NO.3) and TCAAACACCG ACAGAATCAA GGAGCG (SEQ ID NO.4) was used as a primer for PCR amplification. The PCR amplification procedure is: pre-denaturation at 95°C for 3 min...

Embodiment 2

[0032] Example 2: Construction of pET-30a(+)-gfugt88A1 expression vector

[0033] According to the nucleotide sequence of gfugt88A1 obtained by the above-mentioned clone sequencing, codon optimization in Escherichia coli was carried out. The optimized nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2. After adding 6×His tags, it was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0034] SEQ ID NO.1:

[0035] ATGGTTAGGCTAAGAGTTATAGTAGTTACATTTCTAACAACTGCTGCACTATACGACCGTATCAAGAGCGAGATTAGCCGTAGCTTCGAGCCGAACGAGGAACACCTGCTGGACCGTATCCGTGTTATTGCGCTGCAGAAGAACCTGCAAGATCACTTCGGTGGCGACACCCTGGATACCGCGTTTGAAGACGCGTACAGCAAGCTGATCAGCGAGGAACCGCTGACCTGCGTTAAAACCGGTACCAGCTATGATAGCGTGCGTAGCCCGGATGCGGCGATTGTGGATTTCTTTGCGATTGTTCCGTTCAACGCGGCGAAGAAACTGAACCGTAACGGCGAGGAACGTCGTAACCTGCGTGCGAAGGTGGAGGCGGAAGTTAAACGTAGCGGCCGTCCGTTCAACCTGGTGGCGACCGAGGTTCTGTTTGGTAGCGATGGCAGCGTGGTTCGTATTCCGGGCCTGCCGCCGATGTATGACCACGAGTATAACCCGCAGGACTTCACCTTTAGCGAAGATCTGG...

Embodiment 3

[0042] Embodiment 3: Heterologous expression and purification of GFUGT88A1

[0043] The recombinant expression plasmid pET-30a(+)-gfugt88A1 obtained in Example 2 was transformed into Escherichia coli BL21(DE3), positive clones were screened using a kanamycin resistance plate, and a single colony was picked for colony PCR verification ( image 3 ), pick and inoculate positive colonies successfully verified into 100mL LB (Kan+) liquid medium (tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L), 37°C, 180rpm shaking culture, until OD 600 If it is 0.6-0.8, the genetically modified engineered bacteria are obtained.

[0044] Add isopropylthiogalactopyranoside (IPTG) to the above-mentioned genetically engineered bacteria to a final concentration of 0.5 mM, collect the bacteria after induction at 15° C. for 16 hours, wash the bacteria fully with PBS buffer, and weigh after centrifugation. Add 10 mL of PBS buffer to 1 g of bacteria, add PBS buffer to fully suspend the bacteria...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Protein molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides grifola frondosa UDP (User Datagram Protocol) glucosyltransferase as well as a coding gene and application thereof, and belongs to the field of edible mushroom molecular biotechnology and genetic engineering. According to the invention, UDP (User Datagram Protocol) glucosyltransferase UGT88A1 is obtained by cloning from Grifola frondosa and is named as GUFGT88A1, and the amino acid sequence of the UDP glucosyltransferase UGT88A1 is shown as SEQ ID NO. 2; the UDP glucosyltransferase is glucosyltransferase on which uridine diphosphate glucose (UDP-glucose) depends; the UDP glucosyltransferase can be used for catalyzing polysaccharide synthesis.

Description

technical field [0001] The invention belongs to the fields of edible fungus molecular biotechnology and genetic engineering, and in particular relates to a grifola frondosa UDP glucosyltransferase, its coding gene and its application. Background technique [0002] Polysaccharides have a complex structure, which is composed of various monosaccharides such as glucose, xylose, galactose and mannose connected by three-dimensional and regional glycosidic bonds. They provide energy, support cell structures and exert biological important component of functionality. At present, the fine structure of plant and microbial polysaccharides has been elucidated by chemical methods such as complete acid hydrolysis, methylation analysis combined with nuclear magnetic resonance (NMR) spectroscopy and atomic force microscopy (AFM). However, the synthetic pathways and catalytic properties of polysaccharide synthesis-related enzymes such as UDP-glucose pyrophosphorylase (UGP), UDP-glycosyltrans...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N1/21C12N15/70C12P19/18C12P19/08C12P19/00C12R1/19
CPCC12N9/1048C12N15/70C12P19/18C12P19/08C12P19/00
Inventor崔凤杰梁英英付鑫孙雷孙文敬
OwnerJIANGSU UNIV