Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid DNA sulfite conversion reagent and method

A sulfite and reagent technology, applied in the field of molecular biology, can solve the problems of reduced sensitivity of analytical techniques, long reaction time, inconvenience, etc., and achieve the effects of reduced DNA degradation, less DNA loss, and wide clinical applicability

Pending Publication Date: 2022-06-03
上海长岛抗体诊断试剂有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 5-mC was discovered more than 60 years ago, but for a long time scientists were unclear about its precise function and significance in the control of gene expression
There are some fatal shortcomings in the traditional sulfite treatment of DNA: in order to ensure a high conversion rate of DNA to eliminate false positive results, the conversion reaction is carried out under high-concentration sulfite solution, high temperature, and long-term reaction conditions, but such severe reaction conditions often Causes DNA degradation, which reduces the sensitivity of subsequent analytical techniques
Traditional sulfite treatment results in 84-96% loss of starting DNA, and the high rate of DNA degradation severely limits the applicability of methylation analysis when the amount of DNA to be analyzed is limited
Especially when analyzing DNA from body fluids, such as blood or urine, the sample DNA often exists in the body fluid at a very small concentration; in addition, the traditional conversion reaction is overnight (~18 hours), and the long reaction time brings great difficulties to practical work. many inconveniences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid DNA sulfite conversion reagent and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] Example 1: Sulfate conversion reaction of cultured colon cancer HT29 cell DNA specimens

[0093] 1. Preparation of cellular genomic DNA

[0094] Colon cancer HT29 cell line was cultured according to conventional cell culture methods

[0095] Human monocyte-macrophage THP1 cell line as control cells

[0096] Take 0.5ml of cultured cells (cell density 1×10 7 ), using Qiagen Blood & Cell Culture DNAKits (Cat. 13323), according to the manufacturer's instructions, to extract cellular genomic DNA.

[0097] Take 0.1 μg of DNA for the following sulfite reaction.

[0098] 2. Sulfite conversion reaction system

[0099] Prepare a sulfite conversion reaction system in a 0.5ml PCR tube. The specific preparation system is as follows:

[0100]

[0101] Buffer BS1: DNA protection solution (300mM hydroquinone aqueous solution)

[0102] Bis Mix: 10M Sulfite Conversion Solution (NaHSO 3 , (NH 4 ) 2 SO 3 , NH 4 HSO 3 , pH 5.2–5.3)

[0103] 3. Sulfite conversion reaction

...

Embodiment 2

[0106] Example 2: DNA desulfonation and purification recovery after sulfite treatment

[0107] The procedure according to the inventive method is as follows:

[0108] (1) After the sulfite treatment, transfer the reaction system in the tube to a clean 1.5ml centrifuge tube after a brief centrifugation, add 1ml of 6M guanidine hydrochloride and 40μl of magnetic beads, vortex and mix for 10sec, and let stand at room temperature for 5min;

[0109] (2) Place the centrifuge tube on the magnetic stand for 1 min, and discard the liquid after the magnetic beads are adsorbed;

[0110] (3) Add 600 μl of rinsing solution (containing 80% alcohol, 50 mM Tris Buffer), vortex and mix for 10 sec;

[0111] (4) Place the centrifuge tube on a magnetic stand for 1 min, and discard the liquid after the magnetic beads are adsorbed;

[0112] (5) Add 600 μl of desulfurization solution (containing 0.3N NaOH, 90% EtOH), vortex and mix for 10 sec, and leave at room temperature for 15 min;

[0113](6)...

Embodiment 3

[0122] Example 3: MSP detection of SDC2 methylation gene in HT29 intestinal cancer cells

[0123] SDC2 methylation gene analysis was performed on the transformed DNA of colon cancer cells with the following primers and probes:

[0124] SDC2_MF: TTAATAAGTGAGAGGGCGTCGC (SEQ ID NO: 1)

[0125] SDC2_MR: CGACTCAAACTCGAAAACTC (SEQ ID NO: 2)

[0126] SDC2 TaqMan probe: ROX-CGTAGTTGCGGGCGGCGGGAGTAGGC-BHQ2 (SEQ ID NO:3)

[0127] As an internal control, the transformed ACTB gene was detected by the following primers and probes

[0128] ACTB_MF: TGGTGATGGAGGAGGGTTTAGTAAGT (SEQ ID NO: 4)

[0129] ACTB_MR: AACCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 5)

[0130] ACTB TaqMan probe: CY5-TGTGTTTGTTATTGTGTGTTGGGTGGTGGT-BHQ3 (SEQ ID NO:6)

[0131] Take 5 μl of purified transformed DNA for Real-time PCR analysis of human SDC2 gene methylation:

[0132] (1) Take 0.25μl of primers (SDC2_MF, SDC2_MR, ACTB_MF, ACTB_MR) and 0.125μl of fluorescent probes (SDC2 TaqMan probe, ACTB TaqMan probe), 6μl of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rapid DNA (deoxyribonucleic acid) sulfite conversion reagent and a rapid DNA sulfite conversion method, and particularly discloses a DNA sulfite treatment method which comprises the following steps: DNA is contacted with a conversion reagent in a sulfite reaction system, and the conversion reagent comprises the following components: NaHSO3, (NH4) 2SO3 and NH4HSO3. The reagent disclosed by the invention can be used for quickly and efficiently converting non-methylated cytosine of DNA into uracil with high sensitivity.

Description

technical field [0001] The invention belongs to the technical field of molecular biology. Specifically, it belongs to the technical field of nucleic acid detection, and relates to a method for detecting cytosine methylation in DNA. Background technique [0002] Epigenetics is a new branch of genetics that studies changes in gene expression levels without changing the nucleotide sequence of genes. There are many epigenetic phenomena, such as DNA methylation, histone modification, RNA-mediated gene silencing, and chromosomal inactivation. Among them, DNA methylation is the most important epigenetic mechanism in higher eukaryotes. [0003] The so-called DNA methylation refers to the covalent bonding of a methyl group at the 5' carbon position of the cytosine of the 5'-CpG-3' dinucleotide of the genome under the action of DNA methyltransferase. Methylcytosine (5-mC), which constitutes 2-5% of all cytosine residues. DNA methylation is closely related to human development, gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858
CPCC12Q1/6858C12Q2523/125C12Q2531/113C12Q2535/122C12Q2561/101C12Q2545/113Y02P20/55
Inventor 肖国伟龚伟伟
Owner 上海长岛抗体诊断试剂有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com