Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant yeast strain and IFN alpha-la interferon purifying process

A technology of interferon and yeast, which is applied in the field of purification of α-1a interferon, which can solve the problems of high production cost, large side effects, and low specific activity, and achieve good economic benefits, reduce costs, and shorten purification time.

Inactive Publication Date: 2004-11-24
海南海梁生物高科技有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, most of the α-1a interferon produced in China is the expression product of Escherichia coli, the main process defect is: the expression system of Escherichia coli is a inclusion body type, and renaturation is required in the production process, and the renaturation rate is low, up to 40%. The specific activity is low, only 1.0×10 8 unit / mg of protein, which has relatively large side effects; moreover, expensive monoclonal antibody columns must be used in the separation and purification, and the purity can reach more than 95%. To meet the needs of manufacturers, it takes a lot of money to import, and the production cost is very high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant yeast strain and IFN alpha-la interferon purifying process
  • Recombinant yeast strain and IFN alpha-la interferon purifying process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Construction of IFNα-1a interferon yeast engineering bacteria

[0028] (1) Materials:

[0029] 1. IFNα-1a gene

[0030] 2. pGAPZα-A, P. pastoris Strain GS115 (his4) were purchased from

[0031] Invitrogen, Australia.

[0032] (2) Method:

[0033] 1. Gene PCR amplification:

[0034] (1) Primer design: delete the Kex2 (Lys-Arg) site in the 5' end primer

[0035] The following Ste13 site (Glu-Ala-Glu-Ala) and the initiation codon ATG.

[0036] P1-5'G CTCGAG AAAAGA ATG TGTGATCTGCCTCAAACC3' ("ATG" is removed)

[0037] Xho I Lys-Arg (Kex2 site)

[0038] P2-5'G TCTAGA TCATTCCTTACTTCTTAAACT3'

[0039] wxya

[0040] (2) Thermal cycle: 95°C, 5'; 95°C, 30"→49°C, 30"→72°C, 60"72°C, 10' amplification for 30 cycles.

[0041] 2. PCR amplification product recovery and cloning:

[0042] (1) The IFNα-1a gene was amplified and electrophoresed to obtain a DNA band of about 521bp;

[0043] (2) The target fragment was recovered with a high-p...

Embodiment 2

[0048]Purification method of α-1a interferon: After constructing α-1a interferon yeast engineered bacteria (IFNα-1a / pGAPZα-A / GS115), store the strain at -80°C. Before fermentation, inoculate the plate to activate the strain, inoculate a single colony in YPD+Zeocin100 mg / L medium and ferment for 72 hours, collect the fermentation supernatant by centrifugation, adjust the pH to 4.0-5.0 with acetic acid, and pass through the CM Sepharose column layer Analysis, collect 0.4 mol / L sodium chloride elution peak, add ammonium sulfate to 30%, centrifuge to get supernatant, pass PhenylSepharose column chromatography, collect 10% ammonium sulfate elution peak, pass DEAE Sepharose column chromatography, collect The peak was eluted with 0.1 mol / L sodium chloride, and the protein peak was collected by Sephacryl S-200 column chromatography to obtain a stock solution of α-1a interferon with a purity greater than 95%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the key technology and result of constructing engineering yeast strain IFN alpha-1a / pGAPZ alpha-A / GS115 secreting alpha-1a interferon and the purification process of produced interferon. The present invention adopts yeast secretion expressing system, rather than traditional colibacillus inclusion body expression system, and the target protein alpha-1a interferon has no needs of renaturation, biological specific activity of 1.0E9 unit / mg protein and low toxic side effect. The purification process can obtain target protein alpha-1a interferon of 95 % purity without needing expensive monoclonal antibody column for lowering production cost.

Description

[technical field] [0001] The invention relates to an engineering bacterial strain secreting and expressing alpha-1a interferon and a purification method for producing alpha-1a interferon using it. [Background technique] [0002] At present, most of the α-1a interferon produced in China is the expression product of Escherichia coli, the main process defect is: the expression system of Escherichia coli is a inclusion body type, and renaturation is required in the production process, and the renaturation rate is low, up to 40%. The specific activity is low, only 1.0×10 8 unit / mg of protein, which has relatively large side effects; moreover, expensive monoclonal antibody columns must be used in the separation and purification, and the purity can reach more than 95%. To meet the needs of manufacturers, it takes a lot of money to import, and the production cost is very high. [Content of the invention] [0003] In order to overcome the above defects, the present invention adopt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K1/14C07K14/56C12N1/19C12N15/20C12N15/21C12N15/81
Inventor 梁国栋周鹏夏中宁
Owner 海南海梁生物高科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com