Fusion protein of immune globulin binding structural domain and fluorescence protein and its uses

An immunoglobulin and fusion protein technology, which can be used in hybrid peptides, material testing products, instruments, etc., can solve the problems of long time consumption and high cost, and achieve the effect of simple production process, low cost, and easy mass production.

Inactive Publication Date: 2006-07-26
NANJING UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This traditional method is not only time-consuming and expensive, but more and more animal protectionists are opposing it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of immune globulin binding structural domain and fluorescence protein and its uses
  • Fusion protein of immune globulin binding structural domain and fluorescence protein and its uses
  • Fusion protein of immune globulin binding structural domain and fluorescence protein and its uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Fusion of ZZ protein and green fluorescent protein (EGFP) and its application in immunoassay:

[0039] 1. Cloning of ZZ gene and construction of expression plasmid pET28a-ZZ:

[0040] According to the sequence of the ZZ gene, two primers ZZ-5' (5'CATGAATTCGCGCAACACGATGAAGCC 3') and ZZ-3' (5'CCCAAGCTTCTACCGAGCTCGAATTCGC 3') were chemically synthesized, and two primers ZZ-5' and ZZ-3' were obtained from pEZZ318 The coding sequence of the ZZ gene was obtained by PCR amplification from a plasmid (Amercia Company), and the amplified product was recovered by agarose gel electrophoresis and used for enzyme digestion and ligation. PCR conditions are: 94°C for 5 minutes; 94°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute, a total of 30 cycles; 72°C for 10 minutes; 4°C storage.

[0041] The recovered ZZ PCR product was digested with EcoR I and Hind III, and the plasmid pET28a (Novagen) was also digested with EcoR I and Hind III. The digested and purified ZZ frag...

Embodiment 2

[0056] Example 2: Fusion of ZZ protein and red fluorescent protein (DsRed-Express) and its application in immunoassay

[0057] 1. Cloning of ZZ-DsRed gene and construction of its expression vector:

[0058] The coding sequence of DsRed-Express was obtained from pDsRed-Express (Clontech) by Sal I and EcoR I double digestion, and then inserted into the pDsRed-Express (Clontech) that had been digested with XhoI, treated with alkaline phosphatase, and blunted with T4 DNA polymerase. and pET28a-ZZ filled in with T4 DNA polymerase. After the ligation product was transformed into Top10 competent cells, positive clones were screened by PCR with primers targeting the DsRed-Express coding sequence, and the direction of DsRed-Express gene insertion was checked by BamH I restriction enzyme digestion. DNA sequencing verified the correctness of the coding sequence and reading frame.

[0059] 2. Expression and purification of ZZ-DsRed in Escherichia coli:

[0060] The pZZ-DsRed expression...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apparent molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to bioengineering technical realm. This invention provides a merged protein which is made up of immunoglobulin combined structure field and fluorescent protein as well as the expression of genetic engineering and the method of separation and purification. Using the merged protein which is made up of immunoglobulin combined structure field and fluorescent protein of this invention expressed and purified in biology, medicine. ect realm can do various immunoassay and analysis, such as enzyme joined immunoadsorption analysis, Western Blotting analysis, spot hybridization detecting, immune combinatorial analysis, flowed cytoscopy and so on. This invention also provides two merged fluorescence protein's example of immunoglobulin combined structure field-green fluorescence protein (ZZ-EGF), immunoglobulin combined structure field-red fluorescence protein (ZZ-DsRed).

Description

1. Technical field: [0001] The invention belongs to the field of biotechnology. 2. Background technology: [0002] Immunological detection using antibodies is a routine method widely used in biology, medical research, and clinical detection and diagnosis. At present, conventional immunological detection uses antibodies to recognize antigens first, and then uses secondary antibodies (secondary antibodies), that is, antibodies against the previous antibody (primary antibody) to react. Usually, the secondary antibody is chemically coupled to a protein that can develop color or light through a chemical reaction (such as horseradish peroxidase, alkaline phosphatase), or to a compound that can produce fluorescence (such as FITC), and then achieve the purpose of detection by detecting the image or the change of optical density. Among them, the secondary antibodies used are mainly prepared from animals, and for the primary antibodies of different sources, it is necessary to use sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/09G01N33/533G01N33/53
Inventor华子春黄启来
OwnerNANJING UNIV