Unlock instant, AI-driven research and patent intelligence for your innovation.

Garget-resistant milk cow breeding method

A technology for mastitis and dairy cows, applied in the field of animal breeding, can solve problems such as complicated production and use, drugs that cannot meet the requirements of the development of the dairy industry, and residual odor

Inactive Publication Date: 2007-05-30
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional Chinese medicine preparations are a class of preparations with good application prospects. Except for some residual odors, most of them have good antibacterial and anti-inflammatory effects. to be clarified
With the increasingly large-scale development of the dairy industry, a considerable number of drugs can no longer meet the requirements of the development of the dairy industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Garget-resistant milk cow breeding method
  • Garget-resistant milk cow breeding method
  • Garget-resistant milk cow breeding method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0168] (1) Synthesis of lactoferrin peptide gene

[0169] 1. Design of Lactoferrin Peptide Gene

[0170] Add the lactoferrin signal peptide sequence and stop codon before and after the lactoferrin partial peptide nucleotide sequence, add the enzyme cutting site NotI at the 5' end, and add the enzyme cutting site BamHI at the 3' end, thus forming The complete sequence of is the target sequence Lfcin B:

[0171] gcggccgc atg aag ctc ttc gtc ccc gcc ctg ctg tcc ctt gga gcc ctt gga ctg

[0172] tgt ctg gct ttc aaa tgc cgc cga tgg cag tgg agg atg aag aag ctg ggt gct

[0173] ccc tct atc acc tgt gtg agg agg gcc ttt taa ggatcc

[0174] 2. Design of overlapping primers

[0175] According to the nucleotide sequence of Lfcin B, 4 primers were designed and synthesized:

[0176] LfcinB-F1: 5′-gcggccgcatgaagctcttcgtccccgccctgctgtcccttggagccctt

[0177] LfcinB-R1: 5′-ctgccatcggcggcatttgaaagccagacacagtccaagggctccaagggacag

[0178] LfcinB-F2: 5′-aaatgccgccgatggcagtgggaggatgaagaagctgggt...

Embodiment 2

[0231] (1) Synthesis of bovine tracheal antimicrobial peptide gene

[0232] 1. Design of bovine tracheal antimicrobial peptide gene

[0233] According to the bovine tracheal antibacterial peptide gene sequence with GenBank accession number AF014106, the codons preferred by eukaryotic cells were selected to optimize it, combined with the multiple cloning sites of eukaryotic expression vectors pIRES1-neo and pMD18-T, and designed at both ends of the gene Restriction site, introduce EcoRI restriction site and NotI restriction site at the 5' end, introduce BamHI restriction site at the 3' end, and add corresponding protective bases according to the restriction site. The modified sequence is:

[0234] ggaattc gcggccgc atg agg ctc cat cac ctg ctc ctc gct ctc ctc ttc ctg

[0235] gtc ctg tct gct tcc tca gga ttt act caa gga gta gga aat cct gta agc tgt

[0236] gtt agg aat aaa ggc atc tgt gtg cca atc ​​agg tgt cct gga aac atg aaa cag

[0237] att ggc acc tgt gtc ggg aga gca gt...

Embodiment 3

[0269] (1) Synthesis of sericin B gene

[0270] 1. Design of cecropin B gene

[0271] Refer to the cecropin B gene sequence with the Genbank accession number D11113, select the codons preferred by eukaryotic cells to optimize it, and combine the multiple cloning sites of the expression vectors pIRES1-neo and pMD-18T, considering that it can maintain the correctness after cloning reading frame. Restriction sites are designed at both ends. Introduce EcoRI restriction site and NotI restriction site at the 5' end, introduce BamHI restriction site at the 3' end, and add corresponding protective bases according to the restriction site. The modified sequence is:

[0272] ggaattc gcggccgc atg aat ttc gca aag atc cta tcc ttc gtc ttc gct ctg

[0273] gtg ctg gct ttg agc atg acc agc gct gct ccc gag ccc agg tgg aag atc ttc

[0274] aag aaa att gaa aaa atg ggc agg aac att aga gac ggc atc gtc aaa gct ggc

[0275] cca gct atc gag gtc ctt ggt agc gct aaa gct ata gga aaa tga ggatcc ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invetnio discloses a mastitis-proof cow breeding method, which comprises the following steps: constructing antibiotic peptide gene into astopic expressive carrier of galactophore tissue; extracting external gene to transmit and infect supplying cell; making fiber cell in the core-transplanting supplying cell; sieving to obtain positive cell and stoning oocyte to construct embryo; activating the restructed embryo to culture; transplanting normal breeding embryo into cow uterus synchronuously; obtaining gene-transmitting cloned cow.

Description

technical field [0001] The invention discloses an anti-mastitis dairy cow breeding method, which uses antimicrobial peptides to breed dairy cows with anti-mastitis disease, and belongs to the technical field of animal breeding methods. Background technique: [0002] Mastitis is a frequently-occurring disease in dairy cows. The incidence of mastitis in lactating cows is over 20%. It is one of the important diseases affecting the dairy farming industry. The pathogenesis of mastitis includes the invasion and infection of pathogenic bacteria or mechanical factors, etc., but in general, more than 90% of clinical mastitis and asymptomatic recessive mastitis are caused by bacteria such as staphylococcus, streptococcus and Escherichia coli. caused by sexual infection. At present, the prevention and treatment of mastitis mostly adopt antibiotics, antibiotic mixtures, chemical drugs and hormone anti-inflammatory drugs at home and abroad, and some adopt traditional Chinese medicine pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N15/12C12N15/85C12N15/06A01K67/027
Inventor 扈荣良张锦霞张守峰刘晔郭学军张菲
Owner MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI