Garget-resistant milk cow breeding method
A technology for mastitis and dairy cows, applied in the field of animal breeding, can solve problems such as complicated production and use, drugs that cannot meet the requirements of the development of the dairy industry, and residual odor
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0168] (1) Synthesis of lactoferrin peptide gene
[0169] 1. Design of Lactoferrin Peptide Gene
[0170] Add the lactoferrin signal peptide sequence and stop codon before and after the lactoferrin partial peptide nucleotide sequence, add the enzyme cutting site NotI at the 5' end, and add the enzyme cutting site BamHI at the 3' end, thus forming The complete sequence of is the target sequence Lfcin B:
[0171] gcggccgc atg aag ctc ttc gtc ccc gcc ctg ctg tcc ctt gga gcc ctt gga ctg
[0172] tgt ctg gct ttc aaa tgc cgc cga tgg cag tgg agg atg aag aag ctg ggt gct
[0173] ccc tct atc acc tgt gtg agg agg gcc ttt taa ggatcc
[0174] 2. Design of overlapping primers
[0175] According to the nucleotide sequence of Lfcin B, 4 primers were designed and synthesized:
[0176] LfcinB-F1: 5′-gcggccgcatgaagctcttcgtccccgccctgctgtcccttggagccctt
[0177] LfcinB-R1: 5′-ctgccatcggcggcatttgaaagccagacacagtccaagggctccaagggacag
[0178] LfcinB-F2: 5′-aaatgccgccgatggcagtgggaggatgaagaagctgggt...
Embodiment 2
[0231] (1) Synthesis of bovine tracheal antimicrobial peptide gene
[0232] 1. Design of bovine tracheal antimicrobial peptide gene
[0233] According to the bovine tracheal antibacterial peptide gene sequence with GenBank accession number AF014106, the codons preferred by eukaryotic cells were selected to optimize it, combined with the multiple cloning sites of eukaryotic expression vectors pIRES1-neo and pMD18-T, and designed at both ends of the gene Restriction site, introduce EcoRI restriction site and NotI restriction site at the 5' end, introduce BamHI restriction site at the 3' end, and add corresponding protective bases according to the restriction site. The modified sequence is:
[0234] ggaattc gcggccgc atg agg ctc cat cac ctg ctc ctc gct ctc ctc ttc ctg
[0235] gtc ctg tct gct tcc tca gga ttt act caa gga gta gga aat cct gta agc tgt
[0236] gtt agg aat aaa ggc atc tgt gtg cca atc agg tgt cct gga aac atg aaa cag
[0237] att ggc acc tgt gtc ggg aga gca gt...
Embodiment 3
[0269] (1) Synthesis of sericin B gene
[0270] 1. Design of cecropin B gene
[0271] Refer to the cecropin B gene sequence with the Genbank accession number D11113, select the codons preferred by eukaryotic cells to optimize it, and combine the multiple cloning sites of the expression vectors pIRES1-neo and pMD-18T, considering that it can maintain the correctness after cloning reading frame. Restriction sites are designed at both ends. Introduce EcoRI restriction site and NotI restriction site at the 5' end, introduce BamHI restriction site at the 3' end, and add corresponding protective bases according to the restriction site. The modified sequence is:
[0272] ggaattc gcggccgc atg aat ttc gca aag atc cta tcc ttc gtc ttc gct ctg
[0273] gtg ctg gct ttg agc atg acc agc gct gct ccc gag ccc agg tgg aag atc ttc
[0274] aag aaa att gaa aaa atg ggc agg aac att aga gac ggc atc gtc aaa gct ggc
[0275] cca gct atc gag gtc ctt ggt agc gct aaa gct ata gga aaa tga ggatcc ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 